Wet rot disease of banana (Musa sp.) caused by Pectobacterium carotovorum subsp. carotovorum in Turkey

Figures & data

Table 1. Primers, probe and PCR conditions for the identification of P. c. subsp. carotovorum in this study.

Primers	Sequence	References	Conventional and real time PCR conditions
EXPCCF EXPCCR	(5ʹ-GCCGTAATTGCCTACCTGCTTAAG-3ʹ) (5ʹ-GAACTTCGCACCGCCGACCTTCTA-3ʹ)	(Kang et al., 2003)	Initial denaturation, 4 min at 94°C, followed by 30 cycles Denaturation, 1 min at 94°C, Annealing, 1 min at 60°C, Extension, 2 min at 72°C, Final extension, 7 min at 72°C
INPCCF INPCCR	(5ʹ-TTCGATCACGCAACCTGCATTACT-3ʹ) (5ʹGGCCAAGCAGTGCCTGTATATCC-3ʹ)	(Kang et al., 2003)	Initial denaturation, 4 min at 94°C, followed by 30 cycles Denaturation, 1 min at 94°C, Annealing, 1 min at 66°C Extension, 2 min at 72°C,
			Final extension, 7 min at 72°C
fD1 9rP2	(5ʹ AGAGTTTGATCCTGGCTCAG 3ʹ) (5ʹ ACGGCTACCTTGTTACGACTT 3ʹ)	(Weisburg et al., 1991)	Initial denaturation, 5 min at 95°C, followed by 30 cycles Denaturation, 1 min at 94°C, Annealing, 1 min at 59°C Extension, 2 min at 72°C, Final extension, 5 min at 72°C
HBPCCL HBPCCR	(5ʹ-ATCCGGGTCTGTTGATTTGA-3ʹ) (5ʹ-GCGGAAGAGATGGAAATCG-3ʹ)	(Baki & Basım, 2016)	Initial denaturation, 2 min at 95°C followed by 30 cycles Denaturation, 15 s at 94°C, Annealing, 20 s at 58°C, Extension, 15 s at 72°C, Final extension, 2 min at 72°
Probe	(5ʹ-TGCTGTCC-3ʹ)	(Baki & Basım, 2016)

Fig. 1 Distribution of Pectobacterium carotovorum subsp. carotovorum (Pcc) in the Mediterranean coast of Turkey. (a) Map of Turkey, (b) Banana-producing areas in Turkey, (c) Survey areas in Anamur province. The asterisks indicate the specific locations of the wet rot disease detected.

Fig. 2 (Colour online) Symptoms of banana wet rot disease: (a) swollen and split suckers, (b) cut section of the disease portion showing internal symptoms, (c) advanced stage of wet rot disease, (d) advanced internal necrotic lesion.

Fig. 3 (Colour online) Symptoms of banana wet rot disease: (a) collar wet rot, (b) wet rot in the middle of the pseudo-stem, (c) pseudo-stem tip over in young banana plant, (d) leaf yellowing and tip over in the matured plant.

Fig. 4 (Colour online) Pathogenicity of Pcc on banana plants (Grand Naine): (a) healthy plant inoculated with water, (b) 2 weeks after inoculation, (c) 3 weeks after inoculation, (d) 4 weeks after inoculation. The plants were inoculated with different bacterial concentrations (cfu mL⁻¹): 1 = 10⁶, 2 = 10⁷, 3 = 10⁸ (e) death of the pseudostem.

Fig. 5 Agarose gel (1.5%) of the PCR products of Pcc strains on banana with primer pairs (a) fD1/rP2 based on 16S rDNA, (b) INPCCF/INPCCR based on pel gene. M – 100 bp DNA ladder; Lanes: 1–41; Pcc 1 – Pcc 41, Lane: 42; Positive control (DSM-30 168), Lane: 43; Negative control, respectively.

Fig. 6 (Colour online) Real-time PCR detection of Pcc isolates using the LNA probe. (a) DSM-30 168 = positive control, HBPcc2 = positive control, DSM-4610 = D. chrysanthemi, DSM-50 259 = P. cichorii, HBPcc4 = Banana Pcc isolate (b) HBPcc-1-HBPcc15 = Pcc banana isolates (c) HBPcc-16-HBPcc30 = Pcc banana isolates. (d) HBPcc-31-HBPcc41 = Pcc banana isolates, DSM-30 168 = positive control.

Fig. 7 (Colour online) Real-time PCR detection of Pcc from macerated banana plant tissue using LNA probe. DSM-30 168 = positive control.

Fig. 8 Maximum likelihood tree showing the phylogenetic relationship between the Turkish isolates and other strains from NCBI GenBank based on pel gene. Bootstrap values (expressed as percentages of 1000 replications) are shown at the nodes.

Fig. 9 Maximum likelihood tree showing the phylogenetic relationship between the Turkish isolate and other strains from NCBI GenBank based on 16S rDNA. Bootstrap values (expressed as percentages of 1000 replications) are shown at the nodes.

Kang HW, Kwon SW, Go SJ. 2003. PCR-based specific and sensitive detection of Pectobacterium carotovorum spp. carotovorum by primers generated from URP-PCR fingerprinting-derived polymorphic band. Plant Pathol. 52:127–133.

 Web of Science ®Google Scholar

Weisburg WG, Barns SM, Pelletier DA, Jane DJ. 1991. 16S ribosomal DNA amplification for phylogenetic study. J Bacteriol. 173:697–703.

 PubMed Web of Science ®Google Scholar

Baki D, Basım H 2016. Identification and detection of Dickeya chrysanthemi, Pectobacterium carotovorum subsp. carotovorum, Pseudomonas cichorii, Pseudomonas corrugata, Pseudomonas fluorescens, Pseudomonas mediterranea and Pseudomonas viridiflava, causal agents of tomato (Solanum lycopersicum L.) pith necrosis disease by Real-Time PCR. 6th Plant Protection Congress with International Participation, (pp. 550). Konya (Turkey).

 Google Scholar