Pyramiding stem rust resistance genes to race TTKSK (Ug99) in wheat

Figures & data

Table 1. Resistance genes, their chromosome location, linked molecular markers, and PCR primers used for marker assisted selection in this study.

Gene (trait)	Chromosome location	Linked marker	Primer pair	Reference
Sr33	1D	Xcfd15	5ʹ CTCCCGTATTGAGCAGGAAG 3’	Sambasivam et al. (2008)
			5ʹ GGCAGGTGTGGTGATGATCT 3’
SrCad	6D	FSD_RSA	5ʹ GTTTTATCTTTTTATTTC 3’	Hiebert et al. (2011)
			5ʹ CTCCTCCCCCCA 3’
Lr34	7D	L34SPF/L34DINT13R2	5ʹ GGGAGCATTATTTTTTTCCATCATG 3’	Laguda et al. (2009)
			5ʹ ACTTTCCTGAAAATAATACAAGCA 3’
		L34DINT9F/L34MINUSR	5ʹ TTGATGAAACCAGTTTTTTTTCTA 3’
			5ʹ GCCATTTAACATAATCATGATGGA 3’
Fhb1	3B	UMN10	5ʹ CGTGGTTCCACGTCTTCTTA 3’	Liu et al. (2008)
			5ʹ TGAAGTTCATGCCACGCATA 3’

Table 2. Frequencies of gene combinations in 68 pyramided DH lines.

Order	Lr34	SrCad	Sr33	Fhb1	Expected Freq.	Expected #	Observed #
1	Lr34	SrCad	Sr33	Fhb1	0.03	2.12	2
2	Lr34	-	Sr33	Fhb1	0.07	4.43	6
3	Lr34	SrCad	-	Fhb1	0.09	5.88	7
4	Lr34	SrCad	Sr33	-	0.04	2.85	5
5	Lr34	SrCad	-	-	0.12	7.91	6
6	Lr34	-	Sr33	-	0.09	5.96	4
7	Lr34	-	-	Fhb1	0.18	12.30	12
8	-	-	Sr33	Fhb1	0.01	0.76	1
9	Lr34	-	-	-	0.24	16.55	16
10	-	SrCad	-	-	0.02	1.36	2
11	-	-	-	Fhb1	0.03	2.12	1
12	-	-	-	-	0.04	2.85	6
13	-	-	Sr33	-	0.02	1.03	0
14	-	SrCad	-	Fhb1	0.01	1.01	0
15	-	SrCad	Sr33	-	0.01	0.49	0
16	-	SrCad	Sr33	Fhb1	0.01	0.37	0
TOTALS					1	68	68

Table 3. Stem rust infection type of various gene stacks.

				Leaf rust
Order	Gene type	Stem rust infection type	FHB infected florets (%)	TDBG	MBDS
1	Lr34-SrCad-Sr33-Fhb1	1-, 1	27.7	1	1+
2	Lr34-Sr33-Fhb1	1-, 1	26.6	1	1-
3	Lr34-SrCad-Fhb1	1-, 1+	35.0	1	1
4	Lr34-SrCad-Sr33	1-, 1	46.0	1+	1+
5	Lr34-SrCad	1-, 1+	48.0	1	1
6	Lr34-Sr33	1-, 1+	45.6	1-	1-
7	Lr34-Fhb1	-	29.5	1-	1-
8	Sr33-Fhb1	2-, 3	32.5	3+	3
9	Lr34	3-, 3+	43.0	1-	1-
10	SrCad	1-, 2	74.5	3	3
‘AC Cadillac’	Lr34-SrCad	1-, 1	100	1-	1-
‘RL5405’	Sr33	2-, 3	86.4	3	3
‘Carberry’	Lr34-Fhb1	3-,	80.0	1-	1-
‘Shaw’	-	3-	85.0	3	3
‘Little Club’	-	3-, 3+	86.0	3	3
‘Sumai3’	-	-	7.3	-	-
‘Roblin’	-	-	96.0	-	-

Fig. 1. (Colour online) Phenotype of susceptible (A) and resistant (B) lines to TTKSK.

Sambasivam PK, Bansal UK, Hayden MJ, Dvorak J, Lagudah ES, Bariana HS. 2008. Identification of markers linked with stem rust resistance genes Sr33 and Sr45. In: Appels R, Eastwood R, Lagudah E, Langridge P, MacKay M, McIntyre L, Sharp P, editors. Proceedings of the 11th international wheat genetics symposium. Vol. 2. Australia: Sydney University Press; p. 351–353.

 Google Scholar

Hiebert CW, Fetch TG, Zegeye T, Thomas JB, Somers DJ, Humphreys DG, McCallum BD, Cloutier S, Singh D, Knott DR. 2011. Genetics and mapping of seedling resistance to Ug99 stem rust in Canadian wheat cultivars ‘Peace’ and ‘AC Cadillac’. Theor Appl Genet. 122:143–149.

 PubMed Web of Science ®Google Scholar

Laguda ES, Krattinger SG, Herrera-Foessel S, Singh RP, Huerta-Espino J, Spielmeyer W, Brown-Guedira G, Selter LL, Keller B. 2009. Gene-specific markers for the wheat gene Lr34/Yr18/Pm38 which confers resistance to multiple fungal pathogens. Theor Appl Genet. 119:889–898.

 PubMed Web of Science ®Google Scholar

Liu S, Pumphrey M, Gill B, Trick H, Zhang J, Dolezel J, Chalhoub B, Anderson J. 2008. Toward positional cloning of Fhb1, a major QTL for Fusarium head blight resistance in wheat. Cereal Res Commun. 36:195–201.

 Google Scholar