Development of EST-derived simple sequence repeat markers for wheat leaf rust fungus, Puccinia triticina Eriks

Figures & data

Table 1.  Virulence phenotypes and group designations of Puccinia triticina isolates

Isolate	Virulence phenotype^1	Virulence (Lr genes)	Region of collection^2	Grouping based on virulence to Lr2a, Lr2c and Lr17a
237-1	MBBS	1, 3, 24, 17a, b, 3bg, 10, 14a, 14b, 15, 20	ON	1
189-1	MBPS	1, 3, 3ka, 17a, 30, b, 3bg, 10, 14a, 14b, 15, 20, 23	SK	1
252-1	MGNS	1, 3, 16, 26, 3ka, 17a, B, 3bg, 10, 14b, 15, 20	PEI	1
168-2	MDPN	1, 3, 24, 3ka, 17a, 30, B, 3bg, 14a, 14b, 15, 20	SK	1
234-2	MLDK	1, 3, 9,17a, b, 3bg, 10, 14a, 14b, 15, 20, 23	ON	1
218-1	MBDS	1, 3, 17a, b, 3bg, 10, 14a, 14b, 15, 20, 23	BC	1
251-1	MCNQ	1, 3, 26, 3ka, 17a, b, 3bg, 10, 14a, 14b, 15, 20	PEI	1
128-2	MDNS	1, 3, 24, 3ka, 17a, B, 3bg, 10, 14a, 14b, 15, 20	MB	1
2-2	MLDJ	1, 3, 9, 17a, B, 3bg, 10, 14a, 14b, 15, 20	MB	1
193-1	MLDS	1, 3, 9, 17a, B, 3bg, 10, 14a, 14b, 15, 20, 23	SK	1
243-2	MLBN	1, 3, 9, 17a, B, 3bg, 10, 14a, 14b, 15, 20, 23	ON	1
187-1	MDDS	1, 3, 24, 17a, B, 3bg, 10, 14a, 14b, 15, 20	SK	1
36-2	MFPS	1, 3, 24, 3ka, 17a, 30, B, 3bg, 10, 14a, 14b, 15, 20	MB	1
243-1	MLBN	1, 3, 9, 17a, B, 3bg, 10, 14a, 14b, 15, 20, 23	ON	1
251-2	MFPS	1, 3, 24, 26, 17a, B, 3bg, 10, 14a, 14b, 15, 20	PEI	1
188-2	MDPS	1, 3, 24, 3ka, 17a, 30, B, 3bg, 10, 14a, 14b, 15, 20	SK	1
215-1	MBBK	1, 3, 3bg, 10, 14a, 14b, 14b, 15, 20, 23, 28	BC	2
245-1	MFRS	1, 3, 24, 26, 3ka, 11, 30, 3bg, 10, 14a, 14b, 15, 20, 23, 28	ON	2
215-2	MBGJ	1, 3, 11, 10, 14a, 14b, 15, 20, 23, 28	BC	2
245-2	MFRJ	1, 3, 24, 26, 3ka, 11, 30, 3bg, 10, 14a, 14b, 15, 20, 28	ON	2
48-2	TDBK	1, 2a, 2b, 2c, 3, 24, 10, 14a, 14b, 15,20, 23, 28	MB	3
153-2	TDBQ	1, 2a, 2b, 2c, 3, 24, 3bg, 10, 14b, 15, 23, 28	MB	3
250-1	TBBJ	1, 2a, 2b, 2c, 3, 24, 3bg, 10, 14a, 14b, 15, 20, 28	QC	3
246-1	TFBS	1, 2a, 2b, 2c, 3, 24, 3bg, 10, 14b, 15, 23, 28	QC	3
41-2	TDBT	1, 2a, 2b, 2c, 3, 24, 3bg, 10, 14a, 14b, 15, 20, 23, 28	MB	3
248-2	TBBS	1, 2a, 2b, 2c, 3, 24, 10, 14a, 14b, 15,	QC	3
244-1	TBBG	1, 2a, 2b, 2c, 3, 24, 3bg, 10, 14a, 14b, 15, 20, 23, 28	ON	3
205-2	TDBG	1, 2a, 2b, 2c, 3, 24, 3bg, 10, 14b, 15, 28	SK	3
172-2	TFBJ	1, 2a, 2b, 2c, 3, 24, 10, 14a, 14b, 15, 20, 28	SK	3
42-1	TDBS	1, 2a, 2b, 2c, 3, 24, 3bg, 10, 14a, 14b, 15, 20, 23, 28	MB	3
185-2	TDBJ	1, 2a, 2b, 2c, 3, 24, 3bg, 10, 14b, 15, 28	SK	3
30-1	TDGH	1, 2a, 2b, 2c, 3, 24, 10, 14b, 15, 28	MB	3
13-2	TFBG	1, 2a, 2b, 2c, 3, 24, 26, B, 3bg, 10, 14b, 15, 23, 28	MB	3
199-2	TBBG	1, 2a, 2b, 2c, 3, 24, 3bg, 10, 14b, 15, 28	SK	3
141-2	TFBG	1, 2a, 2b, 2c, 3, 24, 3bg, 10, 14b, 15, 28	MB	3
Notes: ^1 Puccinia triticina nomenclature according to Long & Kolmer (1989).
^2ON, Ontario; MB, Manitoba; SK, Saskatchewan; QC, Quebec; PEI, Prince of Edward Island.

Fig. 1. Distributions of 14 classes of di- and tri-nucleotide simple sequence repeat motifs in the EST database of P. triticina. Classes of simple sequence repeats described by Jurka & Pethiyagoda (1995) and Katti et al. (2001) were listed as following: 1 = AT/AT; 2 = AG/GA/CT/TC; 3 = AC/CA/TG/GT; 4 = GC/CG; 5 = AAT/ATA/ TAA/ATT/TTA/TAT; 6 = AAG/AGA/GAA/CTT/TTC/TCT; 7 = A AC/ACA/CAA/GTT/TTG/TGT; 8 = ATG/TGA/GAT/CAT/A TC/TCA; 9 = AGT/GTA/TAG/ACT/CTA/TAC; 10 = AGG/GGA/GAG/ CCT/CTC/TCC; 11 = AGC/GCA/CAG/GCT/CTG/TGC; 12 =  ACG/ CGA/GAC/CGT/GTC/TCG; 13 = ACC/CCA/CAC/GGT/GTG/TGG; 14 = GGC/GCG/CGG/GCC/CCG/CGC.

Table 2.  Repeat motif, primer sequence, amplification conditions and characteristics

Locus	Primer sequence	Repeat motif	Ta (˚C)	Na	Allele size range (bp)	Ho	He	FI	Cross amplification
									P. coronata	P. graminis
Ptssr0083	F: ATGGATTTGGAGACCAGTCG	(GA)n	60	2	292–298	0.921	0.497∗∗∗	–0.853	–	–
	R: GTTGAAAGATCTGGGGGTGA
Ptssr6981	F: ACGTGGTGAGGTTTCTGCTC	(ATC)n	59	2	163–171	0.282	0.311	0.093	–	–
	R: TTCCGTTTTTGAAAGCAAGC
Ptssr0019	F: GTTCGGATACCCCGTTTCTC	(ATC)n	60	2	148–153	0.795	0.479∗∗∗	–0.659	+	+
	R: TTTGGAGCATGTTGTTTTGG
Ptssr5649	F: CAGACGACCATCAACATTCG	(CT)n	60	3	189–195	0.923	0.618∗∗∗	–0.493	–	–
	R: CATGAACCAAACAAACAGCTTC
Ptssr0085	F: CCAAAATTATCCCGCCCTAT	(TTT)n	60	2	289–295	0.487	0.369∗∗∗	–0.319	–	–
	R: GCGAGGGGGTAGGAAGTAAT
Ptssr6259	F: GTTCAACACATTGCGCTGTT	(TCA)n	59	2	238–244	0.897	0.611	–0.468	–	–
	R: ATGGGTTGTGCAGATCGAGT
Ptssr2948	F: CACACACCACACAAAACCAA	(GAT)	59	2	117–121	0.615	0.567	–0.084	–	–
	R: CCCAACAAGCTCGTGTCTTT
Ptssr0536	F: TGTTGCGAATTGATGGTACG	(AAA)n	60	2	180–186	0.846	0.5∗∗	–0.692	–	–
	R: GAAGTTCTGCTCTGCTGTCG
Ptssr3233	F: GTAAGCTCGCTTTGGCTACG	(GA)n	60	2	165–167	0.41	0.456∗∗∗	0.101	+	+
	R: TTTGGAGCATGTTGTTTCCA
Ptssr5594	F: CGGACCAAACACAAAGGAAA	(GAT)n	60	4	205–217	0.718	0.579∗∗∗	–0.240	–	–
	R: CCCTGCGTTTAACACCTTGT
Ptssr0189	F: TCTCAACCAAAAATCAATCTACG	(AT)n	58	4	102–118	0.897	0.495	–0.812	–	–
	R: CTTCCACGAAGACGAAGCAC
Ptssr0801	F: CAATGGTAGTGGCAAGCAAA	(TG)n	60	2	201–204	0.59	0.416	–0.418	+	+
	R: GCACCTCTCACGCTCTTAGC
Ptssr6863	F: TAGATGGGCACACAACCAAA	(CT)n	60	2	212–248	0.231	0.251	0.079	+	+
	R: AAGCAAAGTGCAAGGAGCAT
Ptssr0243	F: CTCACTCGCTCGCTTGTTCT	(CA)n+(AT)n	60	4	201–211	0.487	0.369∗∗∗	–0.319	+	+
	R: GACGAAAAGATCGGGTTTGA
Ptssr0125	F: ATCGTGTCATGCAACCAAAA	(GAT)n	59	2	177–183	0.795	0.514	–0.546	–	–
	R: AGAGAGGGACGTGAGGGATA
Ptssr0481	F: CCACAATCCTCCGTTCTGAT	(TTT)n	60	3	192–199	0.897	0.495	–0.812	+	+
	R: CGAAAGCAAAACACATGAGG
Ptssr0639	F: TCTCCGCCTACCAACACTG	(GAA)n	60	2	204–210	0.077	0.163∗∗∗	0.527	+	+
	R: AAAGGAGGGAGAGGGGAGG
Ptssr3145	F: TAGGTGCGTGGTTTTCATCA	(TCTT)	60	2	181–189	0.949	0.637	–0.4898	–	–
	R: CAAATGAGAGCGACGAACAA
Ptssr6542	F: TGTGATCTCGCCCGTACATA	(CT)n	60	4	142–162	0.574	0.325	–0.766	–	–
	R: TGGGAATGATGGACACACAC
Ptssr0182	F: CGAATCCCTTGTCTTTTGCT	(CT)n	59	2	172–174	0.561	0.426	–0.316	–	–
	R: TGTAGAGAGCGGGAGAAGAAA
Ptssr6386	F: AATGAGGTGACTCGGATGGA	(CAT)n	59	2	193–199	0.753	0.653∗∗∗	–0.153	+	+
	R: GAAGAAGGCGAAGTTGTTGC
Notes: F, forward primer; R, reverse primer; Ta, annealing temperature; Na, number of alleles; Ho, observed heterozygosity; He, expected heterozygosity; ∗∗∗; significant deviation from Hardy–Weinberg equilibrium, corrected for multiple comparisons (P < 0.001); FI, Fixation index.

Fig. 2. The clustering structure in the data sets derived from virulence and EST-SSRs. a, Functions of K with the number of clusters for Puccinia triticina isolates based on virulence (□) and EST-SSR genotypes (▪) and b, two-dimensional depiction of clusters at K = 12 differentiated by virulence to 16 differential lines (□, ▵, ∘) and 21 EST-SSR markers (▪, ▴, •). Isolates were grouped based on the virulence to resistance gene Lr2a, Lr2c and Lr17a. Group I (□,▪) are avirulent to Lr2a and Lr2c but virulent to Lr17a. Group II (▵,▴) are avirulent to Lr2a, Lr2c and Lr17a. Group III (∘, •) are virulent to Lr2a and Lr2c but avirulent to Lr17a.

Fig. 3. Genetic dissimilarity dendrogram of 35 Puccinia triticina isolates collected in Canada based on the unweighted pair group method with arithmetic means clustering method using 1-Dice coefficient calculated from 21 EST-SSR markers. Numbers along the nodes are bootstrap values > 70% in 1000 replicas. The first four letters of isolate designation represent virulence phenotypes of P. triticina isolates based on 16 differential lines and the last letter represents the location where the isolate was collected. O, isolates collected in Ontario and Quebec; M, isolates collected in Manitoba and Saskatchewan; B, isolates collected in British Columbia and Alberta; P, isolates collected in Prince of Edward Island. Group I, II and III represent three groups of isolates clustered based on virulence to Lr2a, Lr2c and Lr17a.

Fig. 4. Virulence dissimilarity dendrogram of 35 Puccinia triticina isolates collected in Canada in 2007 based on the unweighted pair group method with arithmetic means clustering method using simple mismatch coefficient (1-simple match coefficient) calculated based on virulence on 16 leaf rust resistance genes. Numbers along the nodes are bootstrap values > 70% in 1000 replicas. The first four letters of isolate designation represent virulence phenotypes of P. triticina isolates based on 16 differential lines and the last letter represents the location where the isolate was collected. O, isolates collected in Ontario and Quebec; M, isolates collected in Manitoba and Saskatchewan; B, isolates collected in British Columbia and Alberta; P, isolates collected in Prince of Edward Island. Group I, II and III represent three groups of isolates clustered based on virulence to Lr2a, Lr2c and Lr17a.

Long , D.L. and Kolmer , A.J. 1989 . A North American system of nomenclature for Puccinia recondita f. sp. tritici . Phytopathology , 79 : 525 – 529 .

 Web of Science ®Google Scholar

Jurka , J. and Pethiyagoda , C. 1995 . Simple repetitive DNA sequences from primates: Complication and analysis . J. Mol. Evol. , 40 : 120 – 126 .

 PubMed Web of Science ®Google Scholar

Katti , M.V. , Ranjekar , P.K. and Gupta , V.S. 2001 . Differential distribution of simple sequence repeats in eukaryotic genome sequences . Mol. Biol. Evol. , 18 : 1161 – 1167 .

 PubMed Web of Science ®Google Scholar