Sequence analysis of the genes encoding for H⁺/K⁺‐ATPase in autoimmune gastritis

Figures & data

Table I. Clinical data, serum PG I concentrations, parietal cell and H. pylori antibodies, and histology of the antrum for the autoimmune gastritis (AIG) patients.

No	Gender	Age	Age at dg	PG 1	PCA	Hp ab	Antrum
1	F	50	43	6	257	100	0
2	F	56	53	10	172	50	0
3	F	49	47	14	165	2200	0
4	M	62	43	16	20	50	1
5	F	63	61	6	89	50	1
6	F	54	51	16	32	50	1,2
7	F	38	34	6	509	50	2
8	F	56	51	6	117	100	0
9	F	52	52	6	66	50	0
10	F	52	52	<5	48	1400	0
11	F	47	32	25	462	730	0
12	F	52	52	20	283	50	0

age at dg = age at diagnosis of atrophic gastritis or pernicious anaemia;

PG 1 = serum pepsinogen I level, µg/L;

PCA = parietal cell antibodies, U/mL;

Hp ab = H. pylori antibody titre of the Ig G class, ⩾700 considered elevated;

antrum = histological findings in the antrum (0 = normal, 1 = mild chronic inflammation, 2 = sparse intestinal metaplasia).

Table II. Primers for the ATP4A gene listed by exon.

Exon	Forward primer	Reverse primer
1	5′‐ccaaggagcctgtaatcagc ‐3′	5′‐attccactgcaacccctgt ‐3′
2	5′‐gagttctccctccctccatc ‐3′	5′‐ctggttcccagcctaccc ‐3′
3	5′‐caggagagcccagagcaa ‐3′	5′‐cctctctcctcctccccttt ‐3′
4	5′‐ggtgtgcatgtggaggaaag ‐3′	5′‐cccatgtcctgagcctgt ‐3′
5	5′‐ctgaataaccccaccccttc ‐3′	5′‐ttggagtctctgggatctgg ‐3′
6	5′‐ccgtccacctcaactttggt ‐3′	5′‐ccagtggaggcagcagttac ‐3′
7	5′‐ccccctatccctgagtcg ‐3′	5′‐ccctcagctccctgcatc ‐3′
8	5′‐ggggaagaggactggaagc ‐3′	5′‐gtctccaccatccaccagat ‐3′
9	5′‐ggttctggtccgggagag ‐3′	5′‐cgaagccggctacaccag ‐3′
10	5′‐caggatgcagtgcctgtg ‐3′	5′‐ggagagaaggggcaaggag ‐3′
11	5′‐gtccacagcctcgcctct ‐3′	5′‐ctcctcgcacctggagtct‐3′
12	5′‐cctgctaagaaagggtgtgc ‐3′	5′‐tcttcaacccaaatcctgct ‐3′
13	5′‐ggagattgggctgatctgaa ‐3′	5′‐gtgccagatgtggggaga ‐3′
14	5′‐ggggttctccccacatct ‐3′	5′‐gagaggccggtccaagac ‐3′
15	5′‐cggcctctcactgaccac ‐3′	5′‐cctcctgtgcccacactg ‐3′
16	5′‐ctgtgaggaggctgaggtg ‐3′	5′‐tccatctgcaagcaagtgtc‐3′
17	5′‐accctcagtcccagttcctt ‐3′	5′‐tgcagacactgaggtccaga ‐3′
18	5′‐tgtccctgtctctgtgtcca ‐3′	5′‐aagttgccctgggaagga ‐3′
19	5′‐aggctggactcaggctgtt ‐3′	5′‐caggatctgatgggagttgg ‐3′
20	5′‐cacgtccccaattcctaatg ‐3′	5′‐ctacagccccctccctgt ‐3′
21	5′‐acagggagggggctgtag ‐3′	5′‐aggccaagtgttgaggatca ‐3′
22	5′‐cacccccagcactgagtc ‐3′	5′‐agagacgctgaggacagtgc ‐3

Table III. Primers for the ATP4B gene listed by exon.

Exon	Forward primer	Reverse primer
1	5′‐ tctggcagaggaaactataaagc ‐3′	5′‐ cctcctcctgagctcacct‐3′
2	5′‐ gtgtgcgttaaaatggctga ‐3′	5′‐ cagcctggcctgtcacac ‐3′
3	5′‐ tgtggtgagcatttggagac ‐3′	5′‐ ctcacctgccgtttcacac ‐3′
4	5′‐ actcgcactcagggcttg ‐3′	5′‐ gccctgactgcactgttgta ‐3′
5	5′‐ cagatctcagctccatgggt‐3′	5′‐ cctgacaagctcctttcctg ‐3′
6	5′‐ aaacgcaacacacagacacc ‐3′	5′‐ ttgctttcctttcgctaagtg‐3′
7	5′‐ gagatttttgaaacacctgtcctt ‐3′	5′‐ caaccaggagggtgtcctt ‐3′

Table IV. Single nucleotide polymorphisms (SNPs) of the coding area of genes encoding for H⁺/K⁺‐ATPase α‐ and β‐subunits found in autoimmune gastritis (AIG) patients and blood donors, and dbSNP id numbers for previously known SNPs.

Subunit/exon	Position	Codon change	Amino acid change	Frequency in patients (n = 12)	Frequency in controls	Controls tested	dbSNP id number
α/ex7	T824C	GTC‐>GCG	Val265Ala	11 homoz,	32 homoz,	52	rs2733743
				1 heteroz	20 heteroz
α/ex 11	C1539A	ATC‐>ATA	Ile503Ile	6 heteroz	16 homoz,	51	rs2230181
					17 heteroz
β/ex 7	C797T	GCG‐>GTG	Ala248Val	1 heteroz	None	50	–
β/ex1	A160C	AGG‐>CGG	Arg36Arg	12 homoz	51 homoz	51	rs9285616
β/ex 2	C198T	TAC‐>TAT	Tyr48Tyr	3 homoz,	23 homoz,	51	rs11164142
				7 heteroz	20 heteroz,
					8 not found
β/ex7	G855A	GCG‐>GCA	Ala267Ala	4 heteroz	11 heteroz,	51	rs17852631
					40 not found

homoz = homozygous; heteroz = heterozygous.