Chemerin rs17173608 and vaspin rs2236242 gene variants on the risk of end stage renal disease (ESRD) and correlation with plasma malondialdehyde (MDA) level

Figures & data

Table 1. The used primers for detection of single-nucleotide polymorphisms in chemerin rs17173608 and vaspin rs2236242 genes.

Gene variant	Primers	Sequence (5′ to 3′)
Chemerin rs17173608	FI (G allele)	ATTGCTATAGTCCAGTGCCCTTCG
	RI (T allele)	CCAGTTCCCTCTGTCGGCTTAA
	FO	GTCAGACCCATGCAGTTTTCAAAC
	RO	GAGTTCCTCTCTCAAGCATCAGGG
	FI (T allele)	AAGACGCCGCTTCTGTGCACT
Vaspin rs2236242	RI (A allele)	CACAGGGACCCAGGATAACTTGCT
	FO	GGAGGCAGACCAGGCACTAGAAA
	RO	ACCATCTCTCTGGCTTCAGGCTTC

FI: forward inner; RI: reverse inner; FO: forward outer; RO: reverse outer.

Table 2. Characteristics and distribution of risk factors in patients with end stage renal disease (ESRD) and control subjects in a population from Western Iran.

Parameter	Patients with ESRD (n = 136)	Control subjects (n = 137)	p Value
Age	58.1 ± 13.3	55.7 ± 7.3	.27
Gender (male/female)	89 (66.9%)/44 (33.1%)	85 (62%)/52 (38%)	.4
MDA (µM)	*2.07 (1.77–2.29)	*1.07 (0.89–1.26)	*<.001

* Median and interquartile range (IQR) for non-normally distributed data, and percentages for categorical data.

Table 3. Odd ratio and distribution of chemerin rs17173608 and alleles with respect to T/T or T and vaspin rs2236242 genotypes and alleles with respect to T/T or T respectively in ESRD patients after adjusted sex and age.

	ESRD patients (n = 110) OR (95% confidential interval)	Control subjects (n = 131)
Chemerin genotypes
T/T	91 (82.7%)	95 (72.5%)
T/G	14 (12.7%)	29 (22.1%)
G/G	5 (4.5%) (χ^2 = 3.9, df = 2, p = .14)	7 (5.3%)
Dominant
T/G + G/G vs. T/T	(n = 19 (17.3%) vs. 91) 0.74 (0.5–1.1, p = .046)	(n = 36 (27.5%) vs. 95)
Codominant
T/G vs. T/T	(n = 14 (13.3%) vs. 91) 0.504 (0.25–1.1, p = .037)	(n = 29 (23.4%) vs. 95)
Chemerin alleles
T	n = 196	n = 219
G	0.79 (0.54–1.1, p = .048, n = 24) (χ^2 = 3.6, df = 1, p = .047)	n = 43
Vaspin genotypes
T/T	54 (49.1%)	66 (50.4%)
T/A	44 (40%)	51 (38.9%)
A/A	12 (10.9%) (χ^2 = 0.05, df = 2, p = .98)	14 (10.7%)
Dominant model of vaspin
T/T	54 (49.1%)	66 (50.4%)
T/A‏+A/A	56 (50.9%) (χ^2 = 0.04, df = 1, p = .84) OR = 1.03 (0.8–1.3, p = .848)	65 (49.6%)
Vaspin alleles
T	n = 152	n = 183
A	1.02 (0.84–1.3, p = .85, n = 68) (χ^2 = 0.1, df = 1, p = .85)	n = 79

Odd ratio is an estimate relative risk for disease that was calculated and 95% confidence interval was obtained by using χ² regression binary logistic analysis.

Table 4. Comparison of MDA concentration level between dominant model of chemerin genotypes (G/G/+ T/G vs. T/T) in ESRD subjects and control group.

Chemerin	ESRD patients	Control subjects	p Values
T/T MDA (µM)	2.04 (1.77–2.3)	1.06 (0.89–1.31)	<.001
T/G + G/G MDA (µM)	2 (108–2.2)	1.01 (0.9–1.2)	.001

A non-parametric Mann–Whitney U-test (median and interquartile range (IQR) for non-normally distributed data) was used to calculate the correlation value of serum MDA with dominant model of chemerin genotypes (G/G/+ T/G vs. T/T) patients and control subjects.

Table 5. Comparison of MDA concentration level between dominant model of vaspin genotypes (A/A + T/A vs. T/T) in ESRD subjects and control group.

Vaspin	ESRD patients	Control subjects	p Values
T/T MDA (µM)	2.1 (1.7–2.3)	1.05 (0.85–1.25)	<.001
A/A + T/A MDA (µM)	2.1 (1.8–2.3)	1.1 (0.93–1.28)	.001

A non-parametric Mann–Whitney U-test (Median and interquartile range (IQR) for non-normally distributed data) was used to calculate the correlation value of serum MDA with dominant model of chemerin genotypes (A/A + T/A vs. T/T) patients and control subjects.

Table 6. Haplotype analysis between chemerin rs17173608 G allele and vaspin rs2236242 a allele in ESRD patients compared with control group.   Haplotype frequencies association with response (n = 241, crude analysis).

Chemerin	Vaspin	Group.Ca n (%)	Group.Co n (%)	OR (95% CI)	p Value
T	T	44 (40%)	49 (37.4%)	–	–
A	T	10 (9.1%)	17 (37.4%)	0.65 (0.27–1.6)	.65
T	G	47 (42.7%)	46 (35.1%)	1.07 (0.8–1.42)	.66
A	G	9 (8.2%)	18 (14.5%)	0.81 (0.6–1.1)	.16

Global haplotype association p-value: .41.