The anti-inflammatory effects of curcumin on renal ischemia-reperfusion injury in rats

Figures & data

Table 1. The primers used for real-time PCR analysis.

Gene	Species	Sense strand sequence	Anti-sense strand sequence
TNF-α	rat	AACACGAGTGACAAGCCCGTAG	GTAT CACCAGTTGGTTCTCTTTGA
Il-6	rat	AGGTTCCATGTGCAAGTGTCT	GACAGCCCTGGTCAAAGGTT
IL-8	rat	CTGCAAGAGACTTCCATCCAG	AGTGGTATAGACAGGTCTGTTGG
β-actin	rat	AGAGGGAAATCGTGCGTGAC	CAATAGTGATGACCTGGCCGT

Figure 1. Effects of Curcumin pretreatment on renal function following renal I/R-induced injury. Serum creatinine and BUN were measured to assess the reno-protective effect of Cur against renal I/R. Data are represented as mean ± SEM (n = 10). ***p < .001 (IRI vs. Sham); ^#p < .005 (IRI vs. Cur).

Figure 2. Effects of Curcumin pretreatment on I/R-induced renal histology. Representative microphotographs were taken from the kidneys of the sham, IRI, and Cur groups at the time point of 24 h after renal I/R. Histopathological examination was performed using PAS staining. Semi-quantitative assessment of the histological lesions based on tubular necrosis (B). Data are represented as mean ± SEM (n = 10). ***p < .001 (IRI vs. Sham); ^#p < .001 (IRI vs. Cur).

Table 2. Effects of curcumin pretreatment on the mRNA level of TNF-α, IL-6, and IL-8 in the kidney after renal ischemia-reperfusion injury.

Group	Number	TNF-α (mRNA)	IL-6 (mRNA)	IL-8 (mRNA)
Sham	10	1 ± 0.1	1 ± 0.05	0.95 ± 0.1
IRI	10	12 ± 1.5***	5 ± 0.4***	7.5 ± 0.75***
Cur	10	5 ± 0.5^#	1.5 ± 0.5^##	2.5 ± 0.4^#

Data are represented as mean ± SEM (n = 10).

***p < .001 (IRI vs. Sham); ^##p < .001, ^#p < .05 (IRI vs. Cur).

Table 3. Effects of curcumin pretreatment on the expression of TNF-α, IL-6, and IL-8 in the serum after renal ischemia-reperfusion injury.

Group	Number	TNF-α (pg/ml)	IL-6 (pg/ml)	IL-8 (pg/ml)
Sham	10	100 ± 10	120 ± 20	100 ± 20
IRI	10	1200 ± 200***	550 ± 50***	750 ± 50***
Cur	10	400 ± 150^##	200 ± 30^#	350 ± 40^#

Data are represented as mean ± SEM (n = 10).

***p < .001 (IRI vs. Sham); ^##p < .01, p < .05 (IRI vs. Cur).

Figure 3. Effects of Curcumin pretreatment on the expression of p65 and p-p65 after renal ischemia-reperfusion injury. Western blot analysis was employed to the expression of p65 and p-p65. (A) A representative result for Western blot analysis p65. (B) Semi-quantitative analysis of 10 animals studied in each group. The relative amounts of p-p65 and p65 in each group of rats were normalized by β-actin and presented as a ratio between p-p65 and p65. *p < .05 (IRI vs. Sham); ^#p < .05 (Cur vs. IRI).

Figure 4. Effects of Curcumin pretreatment on the JAK2/STAT3 signaling after renal ischemia-reperfusion injury. Western blot analysis was employed to the expression of JAK2, p-JAK2, STAT3, and p-STATA3. (A) A representative result for Western blot analysis p-JAK2, STAT3, and p-STATA3. (B) Semi-quantitative analysis of 10 animals studied in each group. The relative amounts of p-JAK2, JAK2, STAT3, and p-STATA3 in each group of rats were normalized by β-actin and presented as a ratio between p-JAK2/JAK2 and p-STAT3/STAT3. *p<.05 (IRI vs. Sham); ^#p<.05 (Curcumin vs. IRI). (IRI vs. Sham); ^#p<.05 (Cur vs. IRI).

Figure 5. The structure of curcumin.