IL-4 polymorphisms (rs2227284, rs2243267, and rs2243270) are associated with reduced risk of rheumatoid arthritis

Figures & data

Figure 1. Flow chart of the study design.

Table 1. Primer sequences of PCR and unique base extension.

SNP_ID	Forward-PCRP	Reverse-PCRP	UEP_SEQ
rs2227284	ACGTTGGATGGATGAAGGGTTTCTTGGGTG	ACGTTGGATGCATTATGGAACTCTCTGTAG	AGCTCTCTTTGGTAAATAGGAAAT
rs2243267	ACGTTGGATGTATAGTTTACTCACTGCCGC	ACGTTGGATGAGAAACGCATTGCACAGTGG	cccaCTATCGTGGCAGATTTTTG
rs2243270	ACGTTGGATGCAGTATCAACAGTTGACCCC	ACGTTGGATGACATTCACTCATCCCACCAG	CACCAGCCAGAGGTAACTA
rs2243283	ACGTTGGATGAAACAGTACTGACCATCGCC	ACGTTGGATGTGCTGACAGATCGGTTGTAG	tGGGGAGGAAAAGATGAC

SNP: single nucleotide polymorphism; PCRP: polymerase chain reaction primer; UEP-SEQ: unique base extension primer sequence.

Table 2. Demographic characteristics of controls and RA patients.

Variables		Control (%)	Case (%)	χ^2/t	p
Total		493	493
Age (year)	Mean ± SD	54.02 ± 8.84	54.35 ± 11.95	−0.503	.615
	< 55	241 (48.9)	239 (48.5)	0.016	.899
	≥ 55	252 (51.1)	254 (51.5)
Height (cm)		162.11 ± 7.50	162.03 ± 5.91	0.189	.850
Weight (kg)		59.55 ± 11.34	59.14 ± 8.78	0.636	.525
BMI (kg/m^2)	Mean ± SD	22.48 ± 2.74	22.46 ± 2.53	0.138	.891
	< 24	348 (70.6)	341 (69.9)	0.236	.627
	≥ 24	145 (29.4)	152 (30.1)
Gender	Male	124 (25.2)	134 (27.2)	0.525	.469
	Female	369 (74.8)	359 (72.8)
Smoking	No	311 (63.1)	307 (62.3)	0.069	.792
	Yes	182 (36.9	186 (37.7)
Drinking	No	359 (72.8)	360 (73.0)	0.005	.943
	Yes	134 (27.2)	133 (27.0)
CRP	Negative		221 (44.8)
	Positive		272 (55.2)
RF	Negative		29 (5.9)
	Positive		464 (94.1)
ESR	Negative		137 (27.8)
	Positive		356 (72.2)
ACPA	Negative		69 (14)
	Positive		424 (86)
AKA	Negative		326 (66.1)
	Positive		167 (33.9)

BMI: body mass index; CRP: C-reactive protein; ACPA: anti-cyclic citrullinated peptide antibody; RF: rheumatoid factor; ESR: erythrocyte sedimentation rate; AKA: anti-Keratin antibody.

Continuous variables were compared through Student’s t test; and categorized variables; through Chi-square.

p < .05 was considered to be significant.

Table 3. Basic information of four SNPs in the IL-4 gene.

SNP-ID	Chr	Position	Role	Allele (A/B)	MAF case	MAF control	HWE-p	RegulomeDB
rs2227284	5	132677033	intron	G/T	0.167	0.146	0.422	eQTL/caQTL + TF binding + any motif + Footprint + chromatin accessibility peak
rs2243267	5	132678194	intron	G/C	0.224	0.187	0.520	eQTL/caQTL + TF binding + any motif + Footprint + chromatin accessibility peak
rs2243270	5	132678417	intron	A/G	0.224	0.187	0.520	eQTL/caQTL + TF binding / chromatin accessibility peak
rs2243283	5	132680901	intron	G/C	0.189	0.209	1.000	Other

RA: rheumatoid arthritis; SNP: single nucleotide polymorphism; Chr: chromosome; MAF: minor Allele frequency; HWE: Hardy-Weinberg equilibrium; OR: odds ratio; CI: confidence interval.

p < .05 was considered to be significant.

Table 4. Association between IL-4 polymorphisms and RA risk in overall analysis.

SNP-ID	Model	Genotype	Control (%)	Case (%)	OR (95% CI)	p	FDR-p
rs2227284	Allele	T	821 (83.3)	842 (85.4)	1
		G	165 (16.7)	144 (14.6)	0.85 (0.67–1.09)	.193	0.290
	Codominant	TT	339 (68.8)	352 (71.4)	1
		GT	143 (29.0)	138 (28.0)	0.93 (0.70–1.23)	.611	0.638
		GG	11 (2.2)	3 (0.6)	0.26 (0.07–0.95)	.041	0.098
	Dominant	TT	339 (68.8)	352 (71.4)	1
		GT-GG	154 (31.2)	141 (28.6)	0.88 (0.67–1.16)	.369	0.466
	Recessive	TT-GT	482 (97.8)	490 (99.4)	1
		GG	11 (2.2)	3 (0.6)	0.27 (0.07–0.97)	.026	0.125
	Additive	–	–	–	0.84 (0.65–1.08)	.178	0.285
rs2243267	Allele	C	765 (77.6)	802 (81.3)	1
		G	221 (22.4)	184 (18.7)	0.79 (0.64–0.99)	.039	0.117
	Codominant	CC	294 (59.6)	315 (63.9)	1
		GC	177 (35.9)	172 (34.9)	0.90 (0.69–1.18)	.453	0.518
		GG	22 (4.5)	6 (1.2)	0.26 (0.10–0.64)	.004	0.032
	Dominant	CC	294 (59.6)	315 (63.9)	1
		GC-GG	199 (40.4)	178 (36.1)	0.83 (0.64–1.08)	.163	0.356
	Recessive	CC-GC	471 (95.5)	487 (98.8)	1
		GG	22 (4.5)	6 (1.2)	0.27 (0.11–0.66)	.002	0.048
	Additive	–	–	–	0.78 (0.62–0.98)	.031	0.124
rs2243270	Allele	G	765 (77.6)	802 (81.3)	1
		A	221 (22.4)	184 (18.7)	0.79 (0.64–0.99)	.039	0.104
	Codominant	GG	294 (59.6)	315 (63.9)	1
		AG	177 (35.9)	172 (34.9)	0.90 (0.69–1.18)	.453	0.494
		AA	22 (4.5)	6 (1.2)	0.26 (0.10–0.64)	.004	0.024
	Dominant	GG	294 (59.6)	315 (63.9)	1
		AG-AA	199 (40.4)	178 (36.1)	0.83 (0.64–1.08)	.163	0.326
	Recessive	GG-AG	471 (95.5)	487 (98.8)	1
		AA	22 (4.5)	6 (1.2)	0.27 (0.11–0.66)	.002	0.024
	Additive	–	–	–	0.78 (0.62–0.98)	.031	0.106
rs2243283	Allele	C	800 (81.1)	780 (79.1)	1
		G	186 (18.9)	206 (20.9)	1.14 (0.91–1.42)	.259	0.366
	Codominant	CC	324 (65.7)	313 (63.5)	1
		GC	152 (30.8)	154 (31.2)	1.05 (0.80–1.39)	.706	0.706
		GG	17 (3.5)	26 (5.3)	1.57 (0.83–2.96)	.163	0.301
	Dominant	CC	324 (65.7)	313 (63.5)	1
		GC-GG	169 (34.3)	180 (36.5)	1.11 (0.85–1.44)	.451	0.541
	Recessive	CC-GC	476 (96.5)	467 (94.7)	1
		GG	17 (3.5)	26 (5.3)	1.54 (0.82–2.89)	.170	0.291
	Additive	–	–	–	1.13 (0.91–1.41)	.264	0.352

RA: rheumatoid arthritis; SNP: single nucleotide polymorphism; OR: odds ratio; CI: confidence interval; FDR: false discovery rate.

OR (95% CI) were calculated by logistic regression analysis with adjustment for age; gender; BMI; smoking; and drinking.

p < .05 was considered to be significant.

Figure 2. Forest map of the association between SNPs and RA risk in gender and smoking status stratification. RA: rheumatoid arthritis; SNP: single nucleotide polymorphism; OR: odds ratio; CI: confidence interval; FDR: false discovery rate. p < .05 was considered to be significant.

Figure 3. Forest map of the association between SNPs and RA risk in BMI stratification. RA: rheumatoid arthritis; BMI: body mass index; SNP: single nucleotide polymorphism; OR: odds ratio; CI: confidence interval; FDR: false discovery rate. p < .05 was considered to be significant.

Figure 4. Forest map of the association between SNPs and RA risk in drinking status stratification. RA: rheumatoid arthritis; SNP: single nucleotide polymorphism; OR: odds ratio; CI: confidence interval; FDR: false discovery rate. p < .05 was considered to be significant.

Table 5. Association between IL-4 polymorphisms and clinical indicators of RA patients.

Variables	SNP-ID	N (positive/negative)			OR (95% CI); p
		AA	AB	BB	AA vs. BB	AB vs. BB
CRP	rs2227284	0/3	72/66	200/152	—–	0.83 (0.56–1.23); 0.352
	rs2243267	1/5	91/81	180/135	0.15 (0.02–1.30); 0.085	0.84 (0.58–1.22); 0.369
	rs2243270	1/5	91/81	180/135	0.15 (0.02–1.30); 0.085	0.84 (0.58–1.22); 0.369
	rs2243283	13/13	86/68	173/140	0.81 (0.36–1.80); 0.604	1.02 (0.69–1.51); 0.907
RF	rs2227284	3/0	131/7	330/22	–	1.25 (0.52–2.99); 0.620
	rs2243267	6/0	160/12	298/17	–	0.76 (0.35–1.63); 0.482
	rs2243270	6/0	160/12	298/17	–	0.76 (0.35–1.63); 0.482
	rs2243283	25/1	147/7	292/21	1.8 (0.23–13.93); 0.574	1.51 (0.63–3.63); 0.357
ESR	rs2227284	0/3	106/32	250/102	–	1.35 (0.86–2.14); 0.197
	rs2243267	2/4	127/45	227/88	0.19 (0.04–1.08); 0.061	1.09 (0.72–1.67); 0.675
	rs2243270	2/4	127/45	227/88	0.19 (0.04–1.08); 0.061	1.09 (0.72–1.67); 0.675
	rs2243283	15/11	121/33	220/93	0.58 (0.26–1.30); 0.185	1.55 (0.98–2.44); 0.059
ACPA	rs2227284	1/2	118/20	305/47	0.08 (0.01–0.87); 0.038	0.91 (0.52–1.60); 0.741
	rs2243267	2/4	145/27	277/38	0.07 (0.01–0.39); 0.002	0.74 (0.43–1.26); 0.261
	rs2243270	2/4	145/27	277/38	0.07 (0.01–0.39); 0.002	0.74 (0.43–1.26); 0.261
	rs2243283	21/5	131/23	272/41	0.63 (0.23–1.77); 0.384	0.86 (0.49–1.49); 0.588
AKA	rs2227284	1/2	47/91	119/233	0.98 (0.09–10.91); 0.986	1.01 (0.67–1.53); 0.958
	rs2243267	2/4	59/113	106/209	0.99 (0.18–5.47); 0.987	1.03 (0.70–1.52); 0.885
	rs2243270	2/4	59/113	106/209	0.99 (0.18–5.47); 0.987	1.03 (0.70–1.52); 0.885
	rs2243283	9/17	53/101	105/208	1.05 (0.45–2.43); 0.912	1.04 (0.69–1.56); 0.852

OR: odds ratio; CI: confidence interval; CRP: C-reactive protein; ACPA: anti-cyclic citrullinated peptide antibody; RF: rheumatoid factor; ESR: erythrocyte sedimentation rate; AKA: anti-Keratin antibody.

p < .05 was considered to be significant.

Data availability statement

The datasets generated and/or analyzed during the current study are available from the corresponding author upon reasonable request.