Expression of miR-425-5p in Pancreatic Carcinoma and Its Correlation with Tumor Immune Microenvironment

Figures & data

Table 1. Primer sequences.

Gene	Forward 5’-3’	Reverse 5’-3’
miR-425-5p	GGGGAGTTAGGATTAGGTC	TGCGTGTCGTGGAGTC
U6	CTCGCTTCGGCAGCACA	AACGCTTCACGAATTTGCGT

Figure 1. miR-425-5p was upregulated in PC. (A-B) miR-425-5p expression levels in patient tissues were determined by RT-qPCR. (C) Correlation between miR-425-5p expression in cancer tissues of PC patients and TNM stage was assessed by Spearman correlation analysis. Data were exhibited as mean ± SD and comparisons between two groups were performed using the t-test. **p < 0.01.

Table 2. Changes of immune cell levels in PC (mean ± SD).

Parameters	Adjacent non-tumor tissue (N = 82)	Tumor tissue (N = 82)	p value
CD3+ (%)	72.67 ± 6.13	55.42 ± 8.06	< 0.001
CD4+ (%)	42.16 ± 4.89	28.68 ± 5.53	< 0.001
CD8+ (%)	26.96 ± 2.87	22.37 ± 4.45	< 0.001
CD4+/CD8+	1.56 ± 0.03	1.28 ± 0.03	< 0.001
Treg (CD4 + CD25 + FoxP3+) (%)	4.89 ± 1.27	9.36 ± 2.01	< 0.001
NK (CD56+) (%)	19.26 ± 2.21	14.08 ± 2.37	< 0.001

PC, pancreatic carcinoma; SD, standard deviation; Treg, T regulatory lymphocyte; FoxP3, forkhead box protein 3; NK, natural killer.

Table 3. Changes of immune factor levels in PC (mean ± SD).

Parameters	Adjacent non-tumor tissue (N = 82)	Tumor tissue (N = 82)	p value
IL-2 (pg/mL)	39.21 ± 3.84	15.60 ± 2.61	< 0.001
IL-4 (pg/mL)	10.60 ± 2.49	11.82 ± 3.07	0.006
IL-10 (pg/mL)	11.26 ± 2.03	25.36 ± 4.12	< 0.001
INF-γ (pg/mL)	10.18 ± 1.41	4.81 ± 1.62	< 0.001
TGF-β (ng/mL)	8.12 ± 1.16	24.78 ± 3.14	< 0.001

PC, pancreatic carcinoma; SD, standard deviation; IL, interleukin; IFN, interferon; TGF, transforming growth factor.

Table 4. Correlation analysis between miR-425-5p and immune microenvironment in PC patients.

Parameters	r	p value
CD3+	−0.238	0.032
CD4+	−0.279	0.011
CD8+	−0.280	0.011
Treg	0.226	0.041
NK	−0.238	0.031
IL-2	−0.300	0.006
IL-4	0.211	0.057
IL-10	0.295	0.007
INF-γ	−0.300	0.006
TGF-β	0.296	0.007

PC, pancreatic carcinoma; Treg, T regulatory lymphocyte; NK, natural killer; IL, interleukin; IFN, interferon; TGF, transforming growth factor.

Figure 2. Relationship between miR-425-5p and prognosis in PC patients. Survival curves were plotted using the regular follow-up data. Log-rank was used to test differences in Kaplan-Meier curves.

Table 5. Correlation of miR-425-5p expression with clinical characteristics of PC patients.

Parameters	Low miR-425-5p (N = 41)	High miR-425-5p (N = 41)	p value
Sex (male/female)	28/13	24/17	0.3590
Age (years)	59.16 ± 4.38	60.68 ± 6.53	0.2190
Location of disease onset
Head and neck	30	26	0.3430
Body and tail	11	15
Lymph node metastasis
No	31	20	0.0122
Yes	10	21
TNM stage
I stage	15	0	< 0.001
II stage	22	10
III stage	4	31
CA199 (U/mL)
< 1000	25	14	0.0150
≥ 1000	16	27

PC, pancreatic carcinoma; TNM, tumor node metastasis; CA199; carbohydrate antigen 199.

Table 6. Correlation of miR-425-5p expression with TNM stage.

Parameters	Low miR-425-5p (N = 41)	High miR-425-5p (N = 41)	p value
TNM I stage (N = 15)	1.36 ± 0.15	/	< 0.001
TNM II stage (N = 32)	1.47 ± 0.19	1.89 ± 0.11	< 0.001
TNM III stage (N = 35)	1.61 ± 0.08	1.92 ± 0.12	< 0.001

TNM, tumor node metastasis.

Data availability statement

The datasets used and analyzed during the current study are available from the corresponding author on reasonable request.