Adhesion properties of Lactobacillus rhamnosus mucus-binding factor to mucin and extracellular matrix proteins

Figures & data

Table 1. Primers used in this study.

Primer	Sequence (5′–3′)	Restriction site^*
S1	GAATTCCAACATCTTGTTCCAACCCCAAC	EcoRI
S2	AAGCTTGTTAACCAGGCTAATATTCTCATAGCC	HindIII
S3	GGATCCTTGCCAGCCTCATCCAC	BamHI
S4	GGATCCTTTGTGGATGAGGCTGGCAA	BamHI
S14	CCATGGTTAAGGCGTGCTCAATGGC	NcoI
S19	CTACCATGGTTAAGGCGAGCTCGGT	NcoI
S15	CTCGAGATTAGGTAATCGCCGCTGA	XhoI
1094	TGACAAGGATCCCACCCATTAGTTCAACAAACG	BamHI
1934	TGACAAGGATCCAAGTACAGTCGGCATTATCTC	BamHI

^* Restriction site is underlined.

Fig. 1. Production and purification of His₆-MBF.

Notes: Purified recombinant His₆-MBFs from LGG and FSMM22 were separated by SDS-PAGE and stained with Coomassie Brilliant Blue R-250. Molecular mass standards are indicated on the left.

Fig. 2. Binding of His₆-MBF from FSMM22 to PCM and ECM proteins.

Notes: (a) Overlay dot blot showing binding of His₆-MBF to PCM, laminin (Ln), fibronectin (Fn), collagen IV (Cn IV), and BSA. Bound PCM and ECM proteins were detected using an anti-His tag antibody. (b) Biacore X sensorgrams of the interaction of His₆-MBF with PCM, laminin, fibronectin, collagen IV, and BSA. His₆-MBFs at the indicated concentrations were injected onto a CM5 sensor chip with immobilized PCM or ECM proteins. The measured data (black line) and their global fits are overlaid (red line). The K_D value is indicated in the text and Table

Table 2. Affinity and rate constants for interactions of His₆-MBF from FSMM22 with PCM and ECM proteins determined by SPR analysis.

	ka (1/Ms)	kd (1/s)	KD (M)
PCM	3.8 × 10^4	2.2 × 10^−3	5.8 × 10^−8
Laminin	2.0 × 10^4	3.8 × 10^−3	1.9 × 10^−7
Fibronectin	1.1 × 10^4	2.2 × 10^−3	1.9 × 10^−7
Collagen IV	2.4 × 10^4	3.9 × 10^−3	1.6 × 10^−7
BSA	1.2 × 10^2	1.9 × 10^−3	1.5 × 10^−5

2.

Table 2. Affinity and rate constants for interactions of His₆-MBF from FSMM22 with PCM and ECM proteins determined by SPR analysis.

	ka (1/Ms)	kd (1/s)	KD (M)
PCM	3.8 × 10^4	2.2 × 10^−3	5.8 × 10^−8
Laminin	2.0 × 10^4	3.8 × 10^−3	1.9 × 10^−7
Fibronectin	1.1 × 10^4	2.2 × 10^−3	1.9 × 10^−7
Collagen IV	2.4 × 10^4	3.9 × 10^−3	1.6 × 10^−7
BSA	1.2 × 10^2	1.9 × 10^−3	1.5 × 10^−5

Fig. 3. Effect of different NaCl concentrations on His₆-MBF binding.

Notes: Binding of His₆-MBF (500 nM) from FSMM22 to immobilized PCM and ECM proteins was analyzed by SPR. HBS-EP buffer was supplemented with NaCl to a final concentration ranging from 150–450 mM. Results were expressed as relative percentage His₆-MBF binding compared to 150 mM NaCl. Error bars indicate SD (n = 3).

Fig. 4. Effect of mbf deletion on FSMM22 adhesion to PCM and ECM proteins.

Notes: (a) A genotype analysis of the resultant cm^r gene into the genome-encoded mbf gene was performed by PCR using primer pair S1/S2. Amplified fragments were subjected to agarose gel electrophoresis. Lanes: 1, size maker; 2, wild-type strain; and 3, mbf mutant. The sizes of representative marker fragments are shown to the left (kb). (b) MBF was detected in the whole-cell lysates of FSMM22 wild-type strain (Lane 1), mbf mutant (Lane 2), and mbf-complemented strain (Lane 3) by Western blotting with an anti-MBF antibody. The position of the MBF protein is highlighted (arrow). The sizes of representative marker fragments are shown to the left (kDa). (c) Adhesion was examined for FSMM22 wild-type strain (black bar), mbf mutant (white bar), and mbf-complemented strain (gray bar) to PCM, laminin, fibronectin, collagen IV, and BSA. Asterisks indicate significant differences in binding (*p < 0.05) compared to wild-type strain, as analyzed by one-way ANOVA with the Dunnett’s post hoc test. (n = 5).

Fig. 5. Expression of MBF in LGG and 14 FSMM strains.

Notes: MBF in the bacterial cell wall surface extracts of L. rhamnosus strains was detected by Western blotting with an anti-MBF antibody. The sizes of representative marker fragments are shown to the left of the panel.