Rapid evaluation of 1-kestose producing β-fructofuranosidases from Aspergillus species and enhancement of 1-kestose production using a PgsA surface-display system

Figures & data

Table 1. Plasmids and oligonucleotide primers used.

Plasmid name or oligonucleotide primer name	Explanation of plsamid or sequence
pCDFDuet-1 pCDF-PgsA pCDF-PgsA-AkFFase pCDF-PgsA-AoFFase pCDF-PgsA-AtFFase pCDF-PgsA-AkFFase G85W	Vector under T7 promoter control, streptpmycin resistance marker Cell surface display vector encoding pgsA gene under T7 promoter control; derivative of pCDFDuet-1 For cell surface display of PgsA-AkFFase fusion protein For cell surface display of PgsA-AoFFase fusion protein For cell surface display of PgsA-AtFFase fusion protein For cell surface display of PgsA-AkFFase G85W fusion protein
PgsA_NdeF PgsA_BglR Kawachii_F Kawachii_R VecInv_F VecInv_R Oryzae_F Oryzae_R Terreus_F Terreus _R kawachiiG85X_F kawachiiG85_R kawachiiG85W_F	aaacatatgaaaaaagaactgagctttcatg aaaagatcttttagattttagtttgtcactatg aaatctaaaagatcctccgtggtcatcgactac tttaccagactcgagtcaatactgacgatccggc ctcgagtctggtaaagaaaccgctgctgcgaaa ggatcttttagattttagtttgtcactatgatcaa acatcacagataacatatgaagctctcaaccgcgagtgcct gagcaagcttctcgagttagacacgctcaggccaggcttca acttcacagataacatatgaaatcctcagtgacacggatgg gagcaagcttctcgagttacctctcgcgctcggggtaagca nnkagcggcatctccagtgccacca atcgtgaaggaagccgacgtggaagagg tggagcggcatctccagtgccacca

Figure 1. HPLC analysis of the products from the incubation of sucrose with E. coli cell suspensions expressing (a) PgsA-AkFFase, (b) PgsA-AoFFase, (c) PgsA-AtFFase, and (d) PgsA-AkFFase G85W.

FN, fructosylnystose; N, nystose; K, 1-kestose; S, sucrose; G, glucose; F, fructose.

Figure 2. Amount of product from the incubation of sucrose with E. coli cell suspensions expressing PgsA-AkFFase, PgsA-AoFFase, PgsA-AtFFase, and PgsA-AkFFase G85W.

Black bar, 1-kestose; Gray bar, nystose. Error bars represent SEM (standard error of the mean). Each bar of PgsA-AkFFase and PgsA-AkFFase G85W corresponds to the average of four experiments, and each bar of PgsA-AoFFase and PgsA-AtFFase corresponds to the average of two experiments.

Figure 3. Stereo view of the catalytic cleft of AkFFase. The model of nystose (green) is obtained from PDB entry 3LEM, and placed on the structure of AkFFase (PDB ID, 5XH8).

Subsite numbers are indicated from −1 to +3.

Figure 4. Time courses of the amounts of sucrose, 1-kestose, and nystose in the reaction using E. coli cell expressing PgsA-AkFFase wild-type enzyme (dotted lines) and PgsA-AkFFase G85W mutant (solid lines).

Symbols: white square, wild-type and sucrose; black square, G85W and sucrose; white circle; wild-type and 1-kestose; black circle, G85W and 1-kestose; white triangle, wild-type and nystose; black triangle, G85W and nystose.

Figure 5. Comparison of amino acid sequences of AkFFase, AoFFase, AtFFase, and A. japonicus FFase (AjFFase).

The sequences were aligned using ClustalOmega server. Colors: red, residues in subsites −1 and +1; black, Gly85 in AkFFase and the corresponding residues; blue, residues located inside the catalytic cleft other than those shown in red or black; green, residues that located distantly from the catalytic site but reportedly influence transfructosylation.