Effects of active site residues of 3α-hydroxysteroid dehydrogenase from pseudomonas sp. b-0831 on its catalysis and cofactor binding

Figures & data

Table 1. The primer sequences for Ps3aHSD using PCR.

primer	sequences (5ʹ → 3ʹ)
Ps3αHSD_Fw	aggagatgcatatgtccgttatcgc
Ps3αHSD_Rv	gcgaattcgcccggcaagccaggcg
S114A_Fw	gatcgtcggtgccattgcggc
S114A_Rv	gccgcaatggcaccgacgatc
Y153F_Fw	gcatttggcttttgccggttcc
Y153F_Rv	ggaaccggaaaagccaaatgc
K157A_Fw	gccggttccgcgtatgcggtg
K157A_Rv	caccgcatacgcggaaccggc

Figure 1. Secondary structure analysis. Far-UV CD spectra of wild-type Ps3αHSD and its mutants, S114A, Y153F, K157A, and S114A/Y153F, are superimposed.

Table 2. Steady-state kinetic constants for Ps3αHSD and its mutants with steroids.

substrate	cofactor	enzyme	Km (mM)	kcat (s^–1)
cholic acid	NAD^+
		wild-type	56 ± 9 ^a	23 ± 4 ^a
		S114A	586 ± 127 ^a	0.80 ± 0.05 ^a
		Y153F	468 ± 68 ^a	0.62 ± 0.04 ^a
		K157A	96 ± 5 ^a	0.045 ± 0.004 ^a
		S114A/Y153F	78 ± 10 ^a a	0.012 ± 0.003
dehydrocholic acid	NADH
		wild-type	51	48
		S114A	239	0.89
		Y153F	2489	1.1
		K157A	n.d.	n.d.

^aAveraged values from the three experiments with standard errors.n.d.; not determined.

Table 3. Thermodynamic parameters for interactions of NADH with Ps3αHSD and its mutants.

	Ka (M^–1)	ΔG (kcal mol^–1)	ΔH (kcal mol^–1)	TΔS (kcal mol^–1)
wild-type	6.7 (± 0.5) × 10^4 a	–6.6	–13.0 (± 0.1) ^a	–6.4
S114A	2.3 (± 0.3) × 10^5 a	–7.3	–13.4 (± 0.2) ^a	–6.1
Y153F	1.7 × 10^4	–5.8	–8.4	–2.6
K157A	n.d	n.d.	n.d.	n.d.
S114A/Y153F	1.2 × 10^5	–6.9	–8.6	–1.7

^aAveraged values from the two experiments with standard errors.

n.d.; not determined due to the small heats generated.

Figure 2. ITC profiles for the binding of NADH to wild-type Ps3αHSD and its mutants. NADH solution was injected into the solution of the wild-type, S114A, Y153F, and K157A.

Figure 3. Relative positions of catalytic residues, Ser114, Tyr153, and Lys157, and NADH in the crystal structure of Ps3αHSD [8]. The distances are indicated as the unit of Å. The image was generated using the program PyMol (http://www.pymol.org/).

Nakamura S, Oda M, Kataoka S, et al. Apo- and holo-structures of 3α-hydroxysteroid dehydrogenase from Pseudomonas sp. B-0831. Loop-helix transition induced by coenzyme binding. J. Biol. Chem. 2006;281:31876–31884.

 PubMed Web of Science ®Google Scholar