Genome-wide identification and characterization of novel microRNAs in seed development of soybean

Figures & data

Figure 1. Workflow of miRNA Digger. miRNA Digger is free for download from http://www.bioinfolab.cn/miRNA_Digger/index.html [29].

Figure 2. Novel miRNA-miRNA* duplexes discovered in soybean. A-P: The newly identified miRNAs and miRNA*s (marked with lines) were mapped to the pre-miRNAs. The degradome-supported DCL1-mediated cleavage signals were marked with arrows.

Figure 3. Novel miRNA, gam-miR482-5p.2, uncovered from known pre-miRNA. A: The newly identified gam-miR482-5p.2/gam-miR482-5p.2* (marked with lines) and miRBase registered gam-miR482-5p/gam-miR482-3p (marked with dotted lines) were mapped to the pre-miRNA. The degradome-supported DCL1-mediated cleavage signal was marked with arrow. B: Expression of gam-miR482-5p.2, gam-miR482-5p.2*, gam-miR482-5p and gam-miR482-3p in six tissues.

Figure 4. isomiRs uncovered in known precursors. The miRNA Digger discovered isomiRs/isomiRs* (marked with lines) and miRBase registered miRNAs counterparts (marked with dotted lines)were mapped to the pre-miRNAs. The degradome-supported DCL1-processing sites were marked with arrow.

Figure 5. Expression profiling of novel miRNAs. The expression pattern of novel miRNAs in cotyledon stage across six different tissues, including: Embryo Proper (EP), Embryo Proper Cotyledon (EPC), Seed Coat Epidermis (SCE), Seed Coat Hilum (SCH), Seed Coat Inner Integument (SCII) and Seed Coat Outer Integument (SCOI) were analyzed and the log2 transformed values of abundance are displayed as a heat map.

Figure 6. Expression profiling of isomiRs and their miRNA counterparts. The expression pattern of newly discovered isomiRs and their miRBase-registered mature miRNA counterparts in cotyledon stage across six different tissues, including: Embryo Proper (EP), Embryo Proper Cotyledon (EPC), Seed Coat Epidermis (SCE), Seed Coat Hilum (SCH), Seed Coat Inner Integument (SCII) and Seed Coat Outer Integument (SCOI) were analyzed and the log2 transformed values of abundance are displayed as a heat map.

Table 1. Targets of novel miRNAs.

miRNA Sequence	cDNA ID	miRU start-ending	PARE cut sites	Gene annotation
gma-miRNA-1	Glyma02g13370.1	1209–1229	1220	squamosa promoter-binding protein-like 6 (SPL6)
	Glyma02g30670.1	758–778	769	SPL9; transcription factor
	Glyma03g29900.1	1138–1158	1149	SPL9; transcription factor
	Glyma05g00200.1	1192–1212	1203	squamosa promoter-binding protein-like 6 (SPL6)
	Glyma07g31880.1	601–621	612	SPL3; DNA binding/transcription factor
	Glyma11g36980.1	1213–1233	1224	SPL2; DNA binding/transcription factor
	Glyma16g05900.1	315–335	326	unknown
	Glyma17g08840.1	1001–1021	1012	squamosa promoter-binding protein-like 6 (SPL6)
	Glyma18g00890.1	239–259	250	unknown
	Glyma18g36960.1	713–733	724	SPL9; transcription factor
	Glyma19g32800.1	737–757	748	SPL9; transcription factor
gma-miRNA-7	Glyma14g16730.1	583–604	595	DUF581 family protein
	Glyma17g29790.1	738–759	750	DUF581 family protein

Figure 7. Degradome sequencing data-based validation of the miRNA-target interactions in soybean. Five libraries of degradome sequencing data libraries (GSM647200,GSM848963,GSM848964,GSM848965 and GSM848967) were recruited for T-plot profiling. The IDs of the target transcripts and the corresponding miRNAs are listed on the top. The y axes measure the normalized reads (in RMP, reads per million) of the degradome signals, and the x axes represent the position of the cleavage signals on the target transcripts. The binding sites of the phased siRNA on their target transcripts were denoted by horizontal lines, and the dominant cleavage signals were marked by arrows.

Table 2. Targets of miRNA-triggered secondary ta-siRNAs.

Ta-siRNA ID	Ta-siRNA sequence	Target cDNA ID	miRU Start-ending	PARE cut sites	Gene annotation
Glyma02g17170.1(1742)21 3ʹD11(+) Glyma10g02630.1(2167)21 3ʹD10(+)	CUGCAUUAAGGAUUUCUUGAG	Glyma05g03930.1	564–584	575	Class I peptide chain release factor
Glyma19g39420.1(1752)21 3ʹD8(+)	GGUUGGACAUGCCUGGUUUUG	Glyma01g00720.1	629–649	640	Regulator of Vps4 activity in the MVB pathway protein

Yu L, Shao C, Ye X, et al. miRNA Digger: a comprehensive pipeline for genome-wide novel miRNA mining. Sci Rep. 2016 Jan;6:18901.

 PubMed Web of Science ®Google Scholar