Crystal structure analysis and enzymatic characterization of γ-glutamyltranspeptidase from Pseudomonas nitroreducens

Figures & data

Scheme 1.  

Table 1. Data collection and refinement statistics for PnGGT structures.

PDB entry	5ZJG
Space group	P1
Unit cell parameters (Å)	a = 43.6, b = 53.9, c = 107.3, α = 91.6, β = 100.2 ϒ = 108.1,
Data collection
Resolution limit (Å)	50.0–1.57 (1.60–1.57) ^b
Measured reflections	915,943
Unique reflections	121,960 (5,713)
Redundancy	7.5 (6.0)
Completeness (%)	96.6 (90.6)
< I/σ(I)>	26.3 (2.9)
Rmerge (%)^c	5.2 (52.0)
Rpim (%)^d	2.0 (22.1)
CC1/2 of last shell (%)^e	91.7
Wilson B factor (Å^2)	31.5
Refinement
Final model	338 (A), 194 (B), 336 (C), 194 (D) amino acids, 585 water molecules
Resolution limit (Å)	50.0–1. 70 (1.76–1.70)
Used reflections	95,754 (8077)
Completeness (%)	95.7 (89.7)
Average B-factor (Å^2)
Protein	42.2 (A), 37.7 (B), 39.0 (C), 30.2 (D)
Water	36.3
Ligand	56.3 (B), 89.8 (C), 52.8 (D)
R-factor (%)^f	16.8 (22.9)
Rfree (%)^g	20.1 (26.9)
Root-mean-square deviations
Bond (Å)	0.004
Angle (°)	0.765
Ramachandran plot (%)
Favored region	97.8
Allowed region	2.0
Outlier region	0.2

^aData in the highest resolution shells are given in parentheses.

^bR_merge = Σ_hklΣ_i|I_i(hkl) – < I(hkl)>|/Σ_hklΣI_i(hkl) × 100, where I_i(hkl) is the intensity of individual reflection and < I(hkl)> is the mean intensity of all reflections.

^cR_pim = Σ_hkl[1/(N − 1)]^1/2Σ_i|I_i(hkl) − < I(hkl)> |/Σ_hkl Σ_iI_i(hkl) × 100, where I_i(hkl) is the intensity of individual reflection and < I(hkl)> is the mean intensity of all reflections.

^dCC_1/2 is the correlation coefficient between random half-datasets.

^eR-factor = Σ|F_o –F_c|/03A3|F_o| × 100, where F_o is the observed structure factor and F_c is the calculated structure factor.

^fR_free was calculated from 5% of the reflections selected randomly.

Table 2. Overlapping complementary primers for the site-directed mutagenesis.

Mutant	Nucleotide sequence (5ʹ→3ʹ)
W385T	Forward:TACACCCTCAACACGGACTTCGGCAGCGGC Reverse:GCCGCTGCCGAAGTCCGTGTTGAGGGTGTA
F417Y	Forward:GTGGCCAACGCCTACGGCGTGGTGGGCAGC Reverse:GCTGCCCACCACGCCGTAGGCGTTGGCCAC
W525A	Forward:GAAGATCAGGGCGCGAACATGGGTGACATC Reverse: GATGTCACCCATGTTCGCGCCCTGATCTTC

Figure 1. Comparison of the structure of GGTs. PnGGT is colored in white and the ligands bound in the active site are represented with a space-filling model.

(a) a superposition of EcGGT is colored in blue; (b) HsGGT in yellow. The regions with major difference in PnGGT chain are represented in magenta.

Figure 2. Local structures of substrate binding sites.

(a) Gly and Gly-Gly-bound PnGGT at 1.70 Å resolution. SIGMAA-weighted (F_o-F_c) omit maps for Gly and Gly-Gly (green). These maps are contoured at 3 σ. Ligands and major residues in the active site are drawn as stick models, and the protein is drawn as a line model. Hydrogen bonds are shown in a dashed line. (b) Comparison between the active site structures of PnGGT (pink), EcGGT (blue), and HsGGT (yellow). (c) Schematic diagrams of protein-ligand interactions for a) Gly and GlyGly in the PDB entry 5ZJB, b) peptidyl phosphonate inhibitor in the PDB entry 5B5T, and c) Glu in the PDB entry 5ZCG.

Figure 3. Multiple sequence alignment of GGTs from Pseudomonas nitroreducens, Escherichia coli and human.

Arrows indicate three aromatic amino acids, Trp385, Phe417, and Trp525. Identical amino acid residues are highlighted by black background. Similar amino acid residues are highlighted by gray background.

Figure 4. Effect of substitution of Trp385, Phe417, and Trp525 on hydrolysis and transfer activity of PnGGT.

Black and gray bars represent the specific activity of ϒ-glutamyl-p-nitroanilide hydrolysis and ϒ-L-glutamylhydroxamate synthesis, respectively.