Isolation of four xylanases capable of hydrolyzing corn fiber xylan from Paenibacillus sp. H2C

Figures & data

Table 1. Sugar composition (wt%) of substrate derived from corn.

	Pentose			Uronic acid
	Arabinose	Xylose	Total
Cellfer
Soluble	0.11	0.19	0.30	0.096
Insoluble	18	29	47	2.9
DDGS
Soluble	0.20	0.18	0.38	0.25
Insoluble	4.8	6.9	11.7	1.2

Figure 1. Purification of corn fibre xylan solubilizing enzymes from culture broth of strain H2C.

(a) Relative activity of each fraction obtained by hydrophobic interaction chromatography. The activities were determined by quantification of solubilized AXOS from Cellfer after reaction. The value of the highest activity was defined as 100%. The fractions pooled and subjected to subsequent purification steps are indicated as fr.1 and fr. 2. (b) SDS-PAGE of purified fractions. Lane M: molecular mass standards; lanes 1A, 1B, and 2A: purified fractions. The SDS-PAGE gels were stained with SYPRO Ruby protein gel stain (Thermo Fisher Scientific).

Table 2. Primers used for cloning.

Enzyme	Primer sequences (5ʹ→3ʹ) (F: forward, R: reverse)
Xyn5A	F: ACCACAGCCAGGATCCGTGGTCAGGCATGCAGATGTC R: ATGCGGCCGCAAGCTTTAATTGATTTTGACTAATT
Xyn10B	F: AAGGAGATATACATATGAGTCTTGTAAGCGGCAGCAA R: GGTGGTGGTGCTCGAGATTCCACAGATACACGTTAT
Xyn11A	F: AAGGAGATATACATATGGCGAGCGACGCAATAGTCAA R: GGTGGTGGTGCTCGAGCTGTGCCGATACATTTATAC
Xyn30A	F: AAGGAGATATACATATGGCAACTGACTATTGGCAGAA R: GGTGGTGGTGCTCGAGCCAGACCGTTACGTTCGAGC
B. subtilis GH11	F: AAGGAGATATACATATGGCTAGCACAGACTACTGGCA R: GGTGGTGGTGCTCGAGCCACACTGTTACGTTAGAAC

Table 3. Identification of proteins in active fractions.

Fraction	N-terminal sequence	Protein	GH family	Amino acid ^a	Molecular mass (kDa)^a
1A	ATDYWQNXTD	Xyn11A	11	183	19.9
1B	ASDAIVNLXAEKQL	Xyn30A	30	527	57.8
2A	NSGMQMSKL^b	Xyn5A	5	536	59.6
	SLVSGSKFLGNXIAG	Xyn10B	10	446	48.6
	ANPQLVVDLS	Unknown	-	720	77.8

^a Each value was calculated on the basis of genome sequence data, excluding a putative signal peptide sequence.

^b First residue (N) is not consistent with the genome sequence.

Figure 2. Module organizations of Paenibacillus sp. H2C xylanases Xyn5A, Xyn10B, Xyn11A, and Xyn30A.

The size of each enzyme and module is scaled according to the polypeptide chain length. GH, glycoside hydrolase family; CBM, carbohydrate binding module family. a.a., amino acids.

Figure 3. Phylogenetic tree of GH5_35 and GH5_21 enzymes based on maximum likelihood with 100 bootstrap replications.

Xyn5A from Paenibacillus sp. H2C is marked with a star. Bootstrap values <50 are not shown.

Table 4. Degradation activities toward BWX, WAX, and DDGS.

Source organism	Enzyme	Specific hydrolyzing activity (U/mg)^a		Solubilized AXOS from DDGS (mg/mL)^b
		BWX	WAX
Paenibacillus sp. H2C	Xyn5A	ND	11.0	0.471
	Xyn10B	40.9	103	0.353
	Xyn11A	160	368	0.254
	Xyn30A	30.0	ND	0.438
Hungateiclostridium thermocellum	GH5	ND	7.18	0.063
Aeromonas punctata	GH10	13.0	19.4	0.005
Trichoderma longibrachiatum	GH11	175	316	0.039
Bacillus subtilis	GH11	112	203	0.069
Bacteroides ovatus	GH98	ND	ND	0.043

ND: not detected.

^a The results are the means of triplicate experiments and the SD was always <7%.

^bThe concentration of solubilized AXOS was calculated by subtracting the value of the enzyme blank after the incubation for 24 h. The results are the means of duplicate experiments and the SD was always <5%.

Figure 4. Time course of hydrolysis of corn dried distiller’s grains with solubles (DDGS) by 1 µg/mL of enzymes.

Purified enzymes were incubated with 2.5% DDGS in 50 mM Britton-Robinson buffer, pH 6.0. Concentrations of AXOS in soluble fraction was measured. Error bars represent SDs for duplicate reactions, each measured once.

Table 5. Arabinose to xylose ratio of AXOS solubilized from DDGS.

Enzyme(s)	Arabinose/Xylose (A:X ratio)
Xyn5A	0.948 ab
Xyn10B	0.819 c
Xyn30A	0.909 b
Xyn5A+Xyn10B	0.934 ab
Xyn5A+Xyn30A	0.988 a
Xyn10B+Xyn30A	0.923 b

The results are the means of triplicate experiments and the SD was always <3%.

Means followed by identical letters in the column are not different from one another by the Tukey test at the 5% probability level.

The concentration of arabinose and xylose were calculated by subtracting the value of the enzyme blank.

Figure 5. Combinatorial effects of xylanases on release of AXOS (a) and proteins (b) from corn dried distiller’s grains with solubles (DDGS).

Ten µg/mL of a single enzyme or a mixture of 5 µg/mL each of two xylanases, for a total of 10 µg/mL of enzyme, was incubated with 2.5% (w/v) DDGS in 50 mM Britton-Robinson buffer, pH 6.0 for 5 h. The concentration of solubilized AXOS and protein were calculated by subtracting the value of the enzyme blank. Error bars represent SDs for triplicate reactions, each measured once. Bars with identical letters indicate no significant difference from one another by the Tukey test at the 5% probability level.