Methanol production by reversed methylotrophy constructed in Escherichia coli

Figures & data

Figure 1. Schematic diagram of the reversed methylotrophic pathway to produce methanol from F6P or glucose in recombinant E. coli cells.

Table 1. E. coli strains used in this study.

E. coli strain	Relevant characteristic(s)	Source
Rosetta (DE3)	F^−ompT hsdSB(rB^−mB^−) gal dcm(DE3) pRARE (Cam^R)	Novagen
Rosetta (DE3) [pET-23a(+)]	Rosetta (DE3) harboring pET-23a(+)	This study
Rosetta (DE3) [pETmdh-His]	Rosetta (DE3) harboring pETmdh-His	This study
Rosetta (DE3) [pEThps-phi]	Rosetta (DE3) harboring pEThps-phi	[20]
Rosetta (DE3) [pETDuet]	Rosetta (DE3) harboring pETDuet-1	This study
Rosetta (DE3) [pDmHhp]	Rosetta (DE3) harboring pDmHhp	This study

Table 2. Plasmids used in this study.

Plasmid	Relevant characteristic(s)	Source
pBluescript II SK(+)	Cloning vector	Stratagene
pBSmdh	pBluescript II SK(+) derivative; mdh from B. methanolicus S1 without the stop codon	This study
pET-23a(+)	T7 promoter-based expression vector	Novagen
pETmdh-His	pET-23a(+) derivative; mdh from B. methanolicus S1 in frame with C-terminal 6xHis-tag	This study
pEThps-phi	pET-23a(+) derivative; hps-phi	[20]
pETDuet-1	T7 promoter-based expression vector for two genes	Novagen
pDmH	pETDuet-1 derivative; mdh-His6 from pETmdh-His in one of the two multiple cloning sites	This study
pDmHhp	pDmH derivative; hps-phi in the other multiple cloning site	This study

Table 3. Oligonucleotide primers used in this study.

Primer	Sequence (5ʹ-3ʹ)	Purpose
mdh-fw-NheI	CTAGCTAGCATGACAAACTTTTTCATTCC	Amplification of mdh gene excluding the stop codon from the genomic DNA of B. methanolicus S1 for construction of pBSmdh
mdh-rv-HindIII(Histag)	CCCAAGCTTCAGAGCGTTTTTGATGATTT
mdh-fw-NcoI	CATGCCATGGGCATGACAAACTTTTTCATTCC	Amplification of mdh-His6 from pETmdh-His for construction of pDmH
mdh-His-rv-EcoRI	GGAATTCTCAGTGGTGGTGGTGGTGGTGCT
MhMp-BglII	GAAGATCTCATGAAGCTCCAAGTCTCCAT	Amplification of hps-phi from pEThps-phi for construction of pDmHhp
MhMp-KpnI	GGGGTACCTCACTCGAGGTTGGCGTGGCGCG

Figure 2. Production of methanol from formaldehyde in a whole-cell reaction of E. coli expressing mdh-His_6.

Figure 3. Production of methanol from F6P in whole-cell reactions of E. coli expressing mdh-His₆ and hps-phi.

Figure 4. Production of methanol from glucose by E. coli expressing mdh-His₆ and hps-phi.

Orita I, Sakamoto N, Kato N, et al. Bifunctional enzyme fusion of 3-hexulose-6-phosphate synthase and 6-phospho-3-hexuloisomerase. Appl Microbiol Biotechnol. 2007;76:439–445.

 PubMed Web of Science ®Google Scholar