The role of abnormal hypermethylation of the HOXA10 and HOXA11 promoters in implantation failures in IVF programs

Figures & data

Table 1. Comparison of demographic and patient characteristics between two groups.

	Group A (n = 10)	Group B (n = 24)	p
Average age (year)^b	33.0(32.0–34.0)	36.0(32.0–39.0)	.053
BMI (kg/m^2)^b	25.9(23.4–26.9)	23.5(20.4–25.6)	.354
Gynecologic and obstetric history
Age of menarche (year)^b	13.0(13.0–14.0)	12.0(13.0–14.0)	.678
Length of period^b	29.0(27.0–30.0)	28.0(27.5–28.0)	.511
Sexually transmitted diseases^a	80.0%(8/10)	50.0%(12/24)	>.05
Endometriosis^a	20.0%(2/10)	12.5%(3/24)	>.05
Endometrial polyps and/or endometrial hyperplasia^a	30.0%(3/10)	37.5%(9/24)	>.05
Infertility history
Duration of infertility (year)^b	5.5(5.0–10.0)	5.5(2.5-9.5)	.834
Etiology of infertility^a			>.05
Tubal factor only	50.0%(5/10)	50.0%(12/24)	–
Tubal factor + male factor	50.0%(5/10)	50.0%(12/24)	–
Type of infertility^a			>.05
Primary infertility	60.0%(6/10)	54.0%(13/24)	–
Secondary infertility	40.0%(4/10)	46.0%(11/24)	–
Gravidity^b	1(0–1)	0(0–2)	1.000
Gravidity after IVF^b	0(0–1)	0(0–0)	.266
Parity^b	0(0–0)	0(0–0)	.623
Spontaneous abortion^b	0(0–1)	0(0–0)	.658
Serum AMH (ng/mL)^b	2.31(1.18–5.47)	1.25(1.01–2.02)	.967

^a Data were presented as relative (%) and absolute frequencies.

^b Data were presented by median (interquartile range).

Group A: women who became pregnant following fresh embryo transfer. Group B: women who did not become pregnant following fresh embryo transfer.

Table

HOXA10F	TATGATATTGTTGTGGGATAATTTG
HOXA10R	CATAAACACCCCACTTATTAACTAC
HOXA11F	ATTAGTATTTTTTTGTTAAGGATGGG
HOXA11R	CCTACAAACAATCTCTATACAC

Table 2. Comparison of methylation levels of HOXA10 and HOXA11 genes between two groups.

	Group A (n = 10)	Group B (n = 24)	p
Methylation of HOXA10 promoter, %	12.07 (0.00–32.00)
	12.07 (0.00–21.14)	11.90 (0.00–33.24)	.658
Methylation of HOXA11 promoter, %	72.56 (55.56–84.21)
	80.65 (57.89–94.74)	68.42 (51.47–78.71)	.150

Data were presented by median (interquartile range).

Group A: women who became pregnant following fresh embryo transfer. Group B: women who did not become pregnant following fresh embryo transfer.

Table 3. Pregnancy prediction model for the logistic regression analysis.

	Model 1	Model 1b	Model 1c	Model 1d
Correctly predicts pregnancy (%)	80.00	70.00	70.00	80.00
Correctly predicts absence pregnancy (%)	88.24	82.35	70.59	76.47
Overall percentage (%)	85.19	77.78	70.37	77.78
p Value	.009	.016	.010	.009

Model 1: the final model which includes: age, level of AMH, duration of infertility, sexually transmitted diseases in history, level of methylation of HOXA10 and HOXA11 genes.

Model 1b: The level of methylation of HOXA10 gene was excluded from Model 1.

Model 1c: The level of methylation of HOXA11 gene was excluded from Model 1.

Model 1d: The levels of methylation of HOXA10 and HOXA11 genes were excluded from Model 1.