Association of vitamin D deficiency and vitamin D receptor (VDR) gene single-nucleotide polymorphism (rs7975232) with risk of preeclampsia

Figures & data

Table 1. Allele flanking and specific primer sequences and their respective PCR product sizes.

Control primers	Forward	CCAAACACTTCGAGCACAAGG	592 bp
	Reverse	AGAGCAGAGTTCCAAGCAGAGG
Allele-specific primers	T-Reverse	GGTGGGATT GAGCAGTGAAGT	312 bp
	G-Reverse	GGTGGGATTGAGCAGTGATGG

Table 2. Demographic and clinical variables between normotensive (control) and preeclamptic (cases) patients.

Variables	Disease	Mean ± SD	95% CI	p value
Age (years)	Yes	33.05 ± 5.267	3.2–7.7	<0.001
	No	27.55 ± 4.914
BMI (m/kg²)	Yes	35.742 ± 4.6465	8.0–11.8	<.001
	No	25.792 ± 3.9651
Pulse	Yes	80.08 ± 4.196	0.4–3.8	.01
	No	77.95 ± 3.449
Systolic (mmHg)	Yes	163.98 ± 16.671	42.6–54.3	<.001
	No	115.50 ± 8.149
Diastolic (mmHg)	Yes	106.25 ± 8.605	31.6–39.3	<.001
	No	70.75 ± 8.883
Fundal height (weeks)	Yes	34.78 ± 2.587	0.1–2.6	.03
	No	33.40 ± 3.112
Gravida	Yes	5.50 ± 3.063	1.1–3.4	<.001
	No	3.20 ± 2.151
Para	Yes	4.025 ± 2.828	1.1–3.2	<.001
	No	1.800 ± 1.771
Period of gestation	Yes	35.21 ± 2.803	0.5–3.1	.007
	No	33.38 ± 3.094
Vitamin D (ng/mL)	Yes	6.790 ± 9.151	–5.8 to 2.3	.44
	No	8.535 ± 9.431
Hb (g/dL)	Yes	11.615 ± 1.387	–0.8 to 0.08	.1
	No	12.003 ± .600

Table 3. Frequency and percentage distribution of different study parameters.

Variables		Frequency	Percent
Disease	Yes	40	50.0
	No	40	50.0
Edema status	No pitting edema	36	45.0
	mild pitting edema	17	21.3
	moderate pitting edema	27	33.8
Genotypes	GG	20	25.0
	GT	43	53.8
	TT	17	21.3
Urine albumin	30-100	24	30.0
	100-300	15	18.8
	300-1000	1	1.3
	Nil	40	50.0
BMI categories	Normal	19	23.8
	Over weight	19	23.8
	Obese	42	52.5
Vitamin D levels (ng/mL)	Normal	2	2.5
	Insufficient	8	10.0
	Deficient	70	87.5
Urine puss cells	Normal	62	77.5
	Infected	18	22.5

Figure 1. Genotype distribution among the two study groups.

Table 4. VDR ApaI (rs7975232) genotypes distribution based on different study variables.

	Genotypes ApaI (rs7975232)			p values
Variables	TT (n = 17)	GG (n = 43)	TG (n = 20)	TT vs TG	TT vs. GG
BMI	32.01 ± 4.9	29.7 ± 6.8	30.7 ± 7.0	.78	.54
Pulse	80.1 ± 4.2	78.4 ± 3.6	78.8 ± 3.9	.46	.36
Systolic	143.2 ± 25.1	140.6 ± 28.4	137.9 ± 28.6	.78	.95
Diastolic	90.2 ± 16.9	90.2 ± 20.2	86.9 ± 20.9	.83	1.0
Fundal height	33.8 ± 2.8	34.3 ± 2.5	34.07 ± 3.1	.97	.90
Gravida	3.8 ± 2.3	4.3 ± 3.4	4.5 ± 2.7	.71	.87
Para	2.6 ± 2.2	2.6 ± 3.0	3.1 ± 2.5	.78	1.0
POG	34.2 ± 3.1	34.4 ± 2.1	34.2 ± 3.2	.99	.99
Vitamin D	3.9 ± 1.8	7.2 ± 6.5	9.3 ± 11.5	.10	.51
Hb	11.7 ± 1.4	12.0 ± 0.9	11.7 ± 0.9	1.0	.69

Table 5. Regression analysis of study variables between disease and control group.

Variables	Phenotype	OR (95% CI)	p value
Genotypes	T	–	–
	G	1.05 (0.56–1.95)	1.0
	TT	–	–
	GG	1.16 (0.31–4.32)	.92
	TG	1.8 (0.57–5.63)	.46
Vitamin D levels	Normal	–	–
	Insufficient	3.5 (0.01–723)	.63
	Deficient	2.4 (0.01–349)	.72
BMI	Normal	–	–
	Overweight	0.2 (0.01–2.2)	.19
	Obese	0.01 (0.001–0.09)	<.001

Table 6. Hardy–Weinberg equilibrium between disease and control group.

Genotype	Observe value	Predictive value	χ2	p value
Cases
TT	10	9.5	0.09	.75
TG	19	20.0
GG	11	10.5
Controls
TT	07	9.0	1.64	.19
TG	24	20.0
GG	09	11.0

Data availability

Available from the corresponding author on reasonable request.