Banana starch intervention ameliorates diabetes-induced mood disorders via modulation of the gut microbiota-brain axis in diabetic rats

Figures & data

Table 1. The major nutritional and functional components of banana powder products.

Classification	Unit	Banana powder
Nutrients	g/100g	Moisture	Protein	Carbohydrates		Fat	Dietary fibre		Ash
		6.5∼8.7	3.0∼3.5	76.0∼77.0		0.4∼0.6	11.0∼13.0		2.1∼2.6
Minerals	mg/100g	Na	K	Ca	Mg	P	Fe	Cu	Zn	Mn
		14.4∼64.6	597∼1491	9.9∼28.4	84∼170	70∼92	1.1∼2.1	0∼0.39	0∼0.6	0.5∼11.0
Vitamin	mg/100g	Beta carotene		Vit B	Vit C		Vit E	Riboflavin	Nick acid
		140∼190		–	2.0∼4.0		0∼0.6	0.07∼0.24	0.6∼2.8
Ingredient	%	Resistant starch	Soluble dietary fibre	Flavonoids		Polyphenols	Polysaccharide	Organic acids	Proanthocyanidin
		56∼65	3.2∼4.8	0.45∼0.83		0.24∼0.35	1.5∼3.2	0.6∼1.2	0.8∼1.0

Table 2. The PCR primer sequence, size, and annealing temperature of selected gut microbiota of Lactobacillus, Bifidobacterium, Enterococcus, Enterobacteria, and Bacteroides.

Objective microbiota	Primer	Primer sequence (5′ to 3′)	Fragment size/bp	Annealing temperature/°C
Lactobacillus	Lac-F	AGCAGTAGGGAATCTTCCA	341	58
	Lac-R	CACCGCTACACATGGAG
Bifidobacterium	Bifid-F	CTCCTGGAAACGGGTGG	550	55
	Bifid-R	GGTGTTCTTCCCGATATCTACA
Bacteroides	Bac-F	GAAGGTCCCCCACATTG	418	56
	Bac-R	CAATCGGAGTTCTTCG
Enterobacteriaceae	Eco-F	CATTGACGTTACCCGCAGAAGAAGC	195	63
	Eco-R	CTCTACGAGACTCAAGCTTGC
Enterococcus	ENco-F	CCCTTATTGTTAGTGCCATCATT	144	61
	ENco-R	ACTCGTTGTACTTCCCATTGT

Figure 1. Effects of banana powder intervention on body weight, food intake, water intake and urine output in normal control group of non-diabetic rats (NCG), standard chow (SCG), and low (LDG), middle (MDG), and high dose (HDG) of banana starch intervention diabetic rats. (A) Bodyweight; (B) Food intake; (C) Water intake; (D) Urine output.

Figure 2. Effect of banana starch diet on fasting blood glucose (FBG) of normal control group of non-diabetic rats (NCG), standard chow (SCG), and low (LDG), middle (MDG), and high dose (HDG) of banana starch intervention diabetic rats. (A) FBG levels in each rat group during 4 weeks of experiments; (B) The area under the FBG curve for each group; (C) The oral glucose tolerance test results of each group within a period of 120 min experiments.

Table 3. Effect of Banana starch on blood insulin and cholesterol levels of normal control non-diabetic rats (NCG), standard chow diabetic rats (SCG), low dose of banana starch diabetic rats (LDG), middle dose of banana starch rats (MDG), and high dose of banana starch diabetic rats (HDG).

Index	Normal group	Standard chow group	Low dose group	Middle dose group	High dose group
Insulin (ng/mL)	2.34 ± 0.35	1.12 ± 0.21^a	1.11 ± 0.12^a	1.25 ± 0.25^a	1.13 ± 0.24^a
Insulin resistance index	0.563 ± 0.041	1.138 ± 0.110^a	0.810 ± 0.096^ab	0.832 ± 0.084^ab	0.759 ± 0.083^ab
Insulin sensitivity index	0.079 ± 0.007	0.039 ± 0.005^a	0.055 ± 0.005^ab	0.0534 ± 0.003^ab	0.059 ± 0.004^ab
Triglyceride	1.70 ± 0.28	3.20 ± 0.25^a	2.27 ± 0.30^ab	2.07 ± 0.24^ab	2.03 ± 0.32^ab
Total cholesterol	1.49 ± 0.11	2.85 ± 0.14^a	2.28 ± 0.26^ab	2.18 ± 0.21^ab	2.17 ± 0.22^ab
HDL cholesterol	1.03 ± 0.17	0.62 ± 0.14^a	1.17 ± 0.17^b	1.20 ± 0.22^Table Footnoteb	1.18 ± 0.10^b
LDL cholesterol	0.45 ± 0.15	2.20 ± 0.14^a	1.10 ± 0.15^ab	0.95 ± 0.24^ab	0.97 ± 0.17^ab
5-HT (pg/ml)	183.43 ± 13.18	468.12 ± 10.22	371.25 ± 15.99	339.16 ± 12.45	357.32 ± 10.85

^a Significant difference compared with NCG, P<0.05;

^b Significant difference compared with SCG, P<0.05.

Figure 3. HE staining imaging of rat pancreatic tissues from normal control group of non-diabetic rats (NCG), standard chow (SCG), and low (LDG), middle (MDG), and high dose (HDG) of banana starch intervention diabetic rats.

Table 4. Effect of Banana starch on liver levels of SOD, MIDA,Free fat acid, total bilirubin, LDH, AST, ALT, TP, ALB, HK, PK, MIDH, SDH, G-6-P in normal control non-diabetic rats (NCG), standard chow diabetic rats (SCG), low dose of banana starch diabetic rats (LDG), middle dose of banana starch rats (MDG), and high dose of banana starch diabetic rats (HDG).

Component and index	Normal group	Standard chow group	Low dose group	Middle dose group	High dose group
Liver index (%)	2.42 ± 0.28	4.41 ± 0.54^a	3.66 ± 0.39^ab	3.42 ± 0.44^ab	3.38 ± 0.46^ab
A/G	5.17 ± 0.73	0.56 ± 0.13^a	2.65 ± 0.25^ab	2.05 ± 0.33^ab	2.63 ± 0.53^ab
Hepatic glycogen (mg/g)	16.62 ± 1.52	6.51 ± 0.87^a	12.72 ± 1.43^ab	12.60 ± 1.02^ab	11.42 ± 1.15^ab
SOD (mmol/L)	122.60 ± 24.80	49.10 ± 8.55^a	68.71 ± 5.51^ab	78.66 ± 8.87^ab	68.29 ± 7.56^ab
MDA (mmol/L)	0.86 ± 0.14	1.37 ± 0.15^a	1.04 ± 0.13^b	0.98 ± 0.13^b	1.02 ± 0.14^b
Free fatty acid (μmol/L)	246.78 ± 19.76	633.05 ± 44.85^a	509.99 ± 35.90^ab	407.99 ± 29.90^ab	443.48 ± 27.34^ab
Total bilirubin (mg/L)	138.80 ± 12.96	160.90 ± 14.45^a	150.00 ± 13.80^a	141.21 ± 14.99^ab	142.80 ± 10.60^ab
LDH (U/L)	1746.79 ± 242.71	4628.28 ± 408.09^a	3883.30 ± 514.11^ab	3326.44 ± 302.55^ab	3439.05 ± 450.71^ab
AST (IU/L)	153.89 ± 5.93	225.34 ± 14.74^a	192.51 ± 9.69^ab	180.25 ± 11.25^ab	172.59 ± 10.24^ab
ALT (IU/L)	71.98 ± 5.66	141.32 ± 9.96^a	108.91 ± 9.94^ab	90.17 ± 9.83^ab	84.75 ± 6.25^ab
TP (g/L)	33.44 ± 1.46	56.89 ± 6.04^a	45.55 ± 6.71^ab	44.78 ± 6.33^ab	40.63 ± 5.77^ab
ALB (g/L)	28.02 ± 4.43	38.48 ± 3.86^a	30.04 ± 3.11^ab	29.36 ± 2.34^ab	29.71 ± 3.01^ab
HK (U/g prot)	90.702 ± 10.559	20.817 ± 3.479^a	40.192 ± 8.086^ab	61.601 ± 12.176^ab	56.682 ± 13.605^ab
PK (U/g prot)	230.287 ± 18.477	140.104 ± 11.045^a	155.642 ± 12.587^ab	178.118 ± 11.066^ab	180.553 ± 15.226^ab
MDH (U/mg prot)	17.329 ± 2.110	6.683 ± 1.008^a	7.228 ± 2.004^a	7.698 ± 2.176^a	6.934 ± 2.603^a
SDH (U/mg prot)	7.508 ± 1.396	2.125 ± 1.187^a	2.264 ± 1.058^a	2.256 ± 1.116^a	2.623 ± 1.1106^a
G-6-P (μmol/mg prot)	0.36 ± 0.11	1.43 ± 0.16^a	1.11 ± 0.15^ab	1.07 ± 0.18^ab	1.04 ± 0.10^ab

Figure 4. HE staining imaging of rat hepatic tissues from normal control group of non-diabetic rats (NCG), standard chow (SCG), and low (LDG), middle (MDG), and high dose (HDG) of banana starch intervention diabetic rats.

Table 5. Effect of Banana starch on gut levels of maltase, sucrase, a-amylase, SCFA, pH in normal control non-diabetic rats (NCG), standard chow diabetic rats (SCG), low dose of banana starch diabetic rats (LDG), middle dose of banana starch rats (MDG), and high dose of banana starch diabetic rats (HDG).

Group	Maltase (U/mg prot)	Sucrase (U/mg prot)	α-Amylase (U/mg prot)	SCFA (mmol/L)	pH
Normal group	156.926 ± 9.231	180.287 ± 13.477	0.172 ± 0.026	60.36 ± 9.84	7.24 ± 0.32
Standard chow group	280.015 ± 13.220^a	320.890 ± 11.214^a	0.620 ± .0.035^a	35.56 ± 7.37^a	7.79 ± 0.36^a
Low-dose group	234.280 ± 8.236^ab	255.70 ± 12.10^ab	0.426 ± 0.058^ab	64.16 ± 9.70^b	6.98 ± 0.47^b
Middle-dose group	220.04 ± 12.268^ab	226.919 ± 11.111^ab	0.353 ± 0.033^ab	98.68 ± 22.40^ab	6.78 ± 0.34^ab
High-dose group	216.37 ± 13.948^ab	210.689 ± 14.09^ab	0.343 ± 0.021^ab	119.52 ± 42.62^ab	6.76 ± 0.33^ab

Table 6. Effect of Banana starch on gut SCFA levels of acetic acid, propionic acid, and butyrate in normal control non-diabetic rats (NCG), standard chow diabetic rats (SCG), low dose of banana starch diabetic rats (LDG), middle dose of banana starch rats (MDG), and high dose of banana starch diabetic rats (HDG).

Group	Dose	0w	1w	2w	3w	4w
Acetic acid	low	21.04 ± 2.40	26.63 ± 2.42^a	30.63 ± 0.80^a	36.85 ± 2.23^a	40.24 ± 1.15^a
	mid	19.52 ± 1.68	32.26 ± 1.94^a	49.60 ± 3.70^a	63.27 ± 5.35^a	75.91 ± 2.34^a
	high	19.32 ± 2.02	33.54 ± 2.46^a	53.84 ± 4.91^a	75.83 ± 6.32^a	90.91 ± 2.34^a
Propionic acid	low	12.74 ± 2.18	10.63 ± 1.65	12.50 ± 1.66	14.12 ± 1.13	14.35 ± 0.50^a
	mid	11.15 ± 2.23	12.83 ± 2.36	14.50 ± 1.37^a	15.90 ± 1.34^a	15.74 ± 2.34^a
	high	10.46 ± 1.07	11.81 ± 0.73	14.74 ± 0.99^a	14.55 ± 1.69^a	15.71 ± 2.34^a
Butyrate	low	4.75 ± 1.07	5.74 ± 0.48	5.34 ± 1.17	6.91 ± 1.31^a	7.98 ± 0.72^a
	mid	4.44 ± 1.18	5.05 ± 1.07	6.20 ± 1.66	7.13 ± 1.24^a	17.92 ± 1.94^a
	high	5.32 ± 1.16	6.52 ± 2.17	8.58 ± 1.05^a	18.65 ± 2.03^a	20.05 ± 2.70^a
5-HT	low	427.2 ± 10.2	413.53 ± 12.87	392.5 ± 15.8^a	375.5 ± 16.3^a	371.3 ± 15.9^a
	mid	419.4 ± 15.4	406.27 ± 15.41	383.4 ± 18.3^a	365.3 ± 14.1^a	339.2 ± 12.5^a
	high	432.9 ± 13.3	419.42 ± 15.02	403.1 ± 14.5^a	383.8 ± 12.5^a	357.3 ± 10.8^a

Table 7. Effect of banana starch on gut microbiota growth of Lactobacillus, Bifidobacterium, Enterococcus, Enterobacteria, and Bacteroides in normal control non-diabetic rats (NCG), standard chow diabetic rats (SCG), low dose of banana starch diabetic rats (LDG), middle dose of banana starch rats (MDG), and high dose of banana starch diabetic rats (HDG).

Group	Bifidobacterium copies/ng	Lactobacillus copies/ng	Bacteroides copies/ng	Enterococcus copies/ng	Enterobacteriaceae copies/ng
Normal group	2202546.3 ± 33759.2	108584.3 ± 24766.0	142.7 ± 56.2	1408.7 ± 431.0	522.0 ± 110.4
Standard chow group	1232386.8 ± 21386.8^a	33457.6 ± 5498.6^a	453.9 ± 117.1^a	3693.7 ± 412.2^a	953.8 ± 82.2^a
Low-dose group	1645129.5 ± 26181.3^ab	48766.7 ± 8568.8^ab	416.3 ± 103.9^a	1677.7 ± 197.8^b	692.2 ± 70.5^ab
Middle-dose group	2018936.7 ± 25273.6^b	95688.3 ± 12073.7^b	391.0 ± 97.9^a	1406.5 ± 252.9^b	520.3 ± 108.4^b
High-dose group	2107093.1 ± 37129.5^b	83236.3 ± 9504.0^b	396.3 ± 81.2^a	1725.8 ± 221.7^b	496.5 ± 0.26^b

Figure 5. Effect of banana powder intervention on mental behaviours in normal control group of non-diabetic rats (NCG), standard chow (SCG), and low (LDG), middle (MDG), and high dose (HDG) of banana starch intervention diabetic rats. (A) Comparison of exhaustive swimming time in each group, (B) Comparison of the behaviours of Immobility Behaviour Counting (IBC), Swimming Behaviour Counting (SBC), Cumulative Immobility Counting (CBC) in each group in the forced swimming test. (C) Comparison of the behaviours of AFT and MSRT in each group in the tail suspension test.

Table 8. Effect of Banana starch on depressive-like behaviours of exhausting swimming, forced swimming and tail suspension tests in normal control non-diabetic rats (NCG), standard chow diabetic rats (SCG), low dose of banana starch diabetic rats (LDG), middle dose of banana starch rats (MDG), and high dose of banana starch diabetic rats (HDG).

Group	Normal group	Standard chow group	Low dose group	Middle dose group	High dose group
Exhaustive swimming time (min)	155.18 ± 9.56	80.98 ± 5.12^a	142.50 ± 12.58^ab	159.00 ± 11.25^ab	153.30 ± 14.82^ab
Immobility behaviour (times)	36.2 ± 5.3	70.6 ± 4.2^a	41.5 ± 7.3^b	40.6 ± 5.2^b	38.8 ± 4.5^b
Swimming behaviour (times)	89.3 ± 11.2	55.9 ± 6.2^a	81.5 ± 8.0^b	87.2 ± 6.3^b	91.5 ± 8.7^b
Climbing behaviour (times)	64.3 ± 8.7	62.1 ± 10.9	69.5 ± 9.1	71.6 ± 11.4	72.5 ± 7.0
Cumulative immobility time (s)	92.5 ± 18.3	146.6 ± 14.2^a	112.5 ± 9.7^b	109.2 ± 12.4^b	98.4 ± 12.1^b
Longest single resting time (s)	35.3 ± 11.7	65.0 ± 8.5^a	46.5 ± 8.2^b	45.2 ± 6.4^b	42.5 ± 5.9^b

Figure 6. The proposed mechanism diagram of banana starch intervention attenuates diabetes-induced depressive-like behaviours via modulation of the gut-microbiota-brain axis.