LCFA Uptake and FAT/CD36: molecular cloning, tissue expression and mRNA expression responses to dietary oil sources in grass carp (Ctenopharyngodon idellus)^*

* The research was conducted in both ‘College of Animal Science and Technology, Northwest A&F University, Yangling, Shaanxi 712100, People’s Republic of China’ and ‘College of Life Science and Technology, Southwest University for Nationalities, Chengdu 610041, People’s Republic of China’.

Figures & data

Figure 1. The hepatocytes incubating with (A) and without (B) QBT, observed in the microscope (×10).

Table 1. Primer sequence for molecular cloning and quantitative real-time PCR of FAT/CD36 in grass carp (C. idellus). All sequences are presented as 5′-3′.

Names		Primer sequences (5′-3′)	Annealing temperature (°C)	Use
FAT/CD36	F	ATGACCTGCTGTGATCTGAAAT	60	For cloning of cDNA
	R	CAAGCATCCCTCCCTTTATT
FAT/CD36	F	GTGTCCAAGGGCTTCAATGA	60	For qPCR
	R	GTGGTAAAGGGGTAAACAGTCATA
β-Actin	F	ATCCTCCGTCTGGACTTGG	55	Endogenous control
	R	TCCGTCAGGCAGCTCATAG

Table 2. Composition and nutrient levels of the experimental diets (air-dry basis, %) for grass carp (C. idellus) used in the in vivo study.

Raw material	Fish oil (FO)	Olive oil (OO)	Groundnut oil (GO)	Linseed oil (LO)
Ingredients
Fish meal	3	3	3	3
Soybean Meal	33.92	33.92	33.92	33.92
Rapeseed meal	19	19	19	19
Cottonseed meal	12	12	12	12
Wheat middling and red dog	15.96	15.96	15.96	15.96
Wheat meal	10	10	10	10
Linseed oil				3
Groundnut oil			3
Olive oil		3
Fish oil	3
NaCl	0.3	0.3	0.3	0.3
Calcium dihydrogen phosphate	1.5	1.5	1.5	1.5
Mineral^a and vitamin^b mix	1.3	1.3	1.3	1.3
Envelope VC	0.02	0.02	0.02	0.02
Total	100	100	100	100
Proximate composition^c
Crude protein	34.54	35.06	35.35	34.93
Crude fat	6.00	6.00	6.08	6.09
Moisture	8.11	7.91	7.94	8.50
Ash	6.34	6.49	6.60	6.36

^aMinerals: Fe (iron sulphate) 140 mg/kg; Cu (copper sulphate) 2.5 mg/kg; Zn (zinc oxide) 65 mg/kg, Mn (manganese oxyde) 19 mg/kg; Mg (magnesium sulphate) 230 mg/kg; Co (cobalt sulphate) 0.1 mg/kg; I (potassium iodine) 0.25 mg/kg; Se (sodium selenite) 0.2 mg/kg.

^bVitamins: vitamin A 4000 IU/kg, vitamin D₃ 800 IU/kg, vitamin E 50 IU/kg, vitamin B₁ 2.5 mg/kg, vitamin B₂ 9 mg/kg, vitamin B₆ 10 mg/kg, vitamin C 250 mg/kg, nicotinic acid 40 mg/kg, pantothenic acid 30 mg/kg, biotin 100 μg/kg, choline 1000 mg/kg.

^cResults are means ± SD (n = 2).

Table 3. FA composition of diets (% of total FA) used in the in vivo study with grass carp (C. idellus).

	Fish oil (FO)	Olive oil (OO)	Groundnut oil (GO)	Linseed oil (LO)
14:0	5.06	0.40	0.46	0.44
16:0	18.78	12.22	13.27	9.54
18:0	3.13	3.23	3.59	3.40
Sum sat^a	26.96	15.85	17.32	13.37
16:1 n-7	5.52	1.09	0.75	0.71
18:1 n-9	18.14	55.62	33.27	23.84
20:1 n-9	4.18	0.94	1.29	1.07
MUFA^b	27.85	57.65	35.31	25.62
18:2 n-6	19.09	19.87	38.53	34.36
20:4 n-6	nd^c	nd	nd	nd
20:3 n-6	0.57	nd	nd	nd
Total n-6 HUFA	19.66	19.87	38.53	34.36
18:3 n-3	4.27	3.06	2.58	22.75
20:5 n-3	6.87	0.79	2.31	0.94
22:6 n-3	8.48	0.48	0.55	0.46
Total n-3 HUFA	19.62	4.33	5.44	24.15
n-3/n-6	1.00	0.22	0.14	0.70

^aSFA, saturated fatty acids.

^bMUFA, monounsaturated fatty acids.

^cnd: not detected.

Figure 2. Time-course uptake of LCFAs in hepatocytes determined by means of the QBT kit from grass carp (C. idellus).

Figure 3. LCFA uptake depending on the OA concentration in hepatocytes from grass carp (C. idellus).

Figure 4. Effects of incubating time on LCFA uptake in hepatocytes from grass carp (C. idellus).

Figure 5. Effects of LCFA uptake depending on the type of FA in hepatocytes from grass carp (C. idellus).

Figure 6. Effects of non-specific inhibitors on LCFA uptake in hepatocytes from grass carp (C. idellus).

Figure 7. Comparison of FAT/CD36 amino acids’ homology in grass carp (C. idellus), common carp (C. carpio) and zebrafish (D. rerio). The line of consensus shows the conserved residues of FAT/CD36 among these fish and these identical amino acid residues are shown in white words with black background. The trans-membrane domain of FAT/CD36 is boxed. The alignment was generated using vector DNAMAN software.

Figure 8. Phosphorylation sites predicted in FAT/CD36 protein.

Figure 9. Secondary structure of FAT/CD36 protein is predicted. The domain of amino acids in blue line are α-helices, the domain of amino acids in red line are β-brands and the amino acids left in purple line are random coils.

Figure 10. Three-dimensional model of FAT/CD36 shown by cartoon and surface models. This protein included many α-helices, β-brands and random coils. It was generafted by PHYRE2 Server.

Figure 11. Phylogenetic analysis of FAT/CD36. Phylogenetic tree based on protein sequences was constructed by the neighbour-joining method with Mega 5.0 software. The strength of branch relationships was assessed by bootstrap replication (N = 1000 replicates). Grass carp FAT/CD36 was indicated by ‘●’. Accession numbers of protein sequences for FAT/CD36 are as follows: Cyprinus carpio (KM030422); Danio rerio (NM_001002363); Homo sapiens (KR710356); Macaca mulatta (AY600441); Rattus norvegicus (NM_031561); Mus musculus (NM_001159558); Lipotes vexillifer (XM_007467039); Bos taurus (NM_001278621); Capra hircus (JF690773); Gallus gallus (NM_001030731); Xenopus (Silurana) tropicalis (NM_001113679).

Figure 12. Expression of FAT/CD36 in different tissues of grass carp (C. idellus) by real-time quantitative PCR analysis. Values are mean ± SD (n = 3). Different letters denote statistically significant differences among tissues (P < .05).

Figure 13. Effect of dietary oil sources on FAT/CD36 expression in grass carp (C. idellus). Values are expressed as means ± SD (n = 8). Different letters denote statistically significant differences among dietary groups (P < .05).