Supplemental-coated zinc oxide relieves diarrhoea by decreasing intestinal permeability in weanling pigs

Figures & data

Table 1. Compositions and nutrient levels of the basal diet (air-dried basis).

Ingredients, %
Corn	52.27
Soybean meal	19.0
Soybean oil	1.6
Extruded full-fat soybean	12.0
Fish meal	4.0
Dried whey	6.0
Dicalcium phosphate	2.0
Limestone	1.0
Sodium chloride	0.25
l-lysine HCl	0.28
dl-methionine	0.6
Vitamin-mineral premix^a	1.0
Analysed nutritional level, %
Digestible energy^b (MJ/kg)	14.47
Crude protein	20.45
Lysine	1.32
Methionine	0.82
Threonine	0.91
Calcium	0.91
Total phosphorus	0.64
Zn (mg/kg)	108.84

^aMineral and vitamin premix provided the following per kilogram of diet: vitamin A, 4000 IU; vitamin D₃, 800 IU; vitamin E, 10 IU; vitamin K₃, 0.5 mg; vitamin B₁₂, 15 mg; pantothenic acid, 10 mg; folic acid, 0.3 mg; niacin, 10 mg; riboflavin, 3.6 mg; biotin, 0.05 mg; thiamine, 1.0 mg; pyridoxine, 1.5 mg; Mn (MnSO₄·H₂O), 10 mg; Cu (CuSO₄·5H₂O), 15 mg; Zn (ZnSO₄), 80 mg; I (KI), 0.14 mg; Se (Na₂SeO₃), 0.15 mg; Fe (FeSO₄), 80 mg.

^bDigestible energy was calculated from data provide by Feed Database in China.

Table 2. Gene-specific primers used in semiquantitative RT–PCR.

Gene^a	Sequence (5′–3′)	Product size (bp)	Annealing (°C)
18S rRNA	GACCAGAGCGAAAGCATT	375	60
	TCCACCAACTAAGAACGG
E-Cadherin	CCCCATGTTCGAATATCCAC	396	59
	TGCTGTGACAAGCCATCTTC
Occludin	GCTGGAGGAAGACTGGAT	244	59
	ATCCGCAGATCCCTTAAC
ZO-1	ACCCACCAAACCCACCAA	123	59
	CCATCTCTTGCTGCCAAACTATC

^aZO-1 = Zonula occludens protein-1; 18S rRNA served as endogenous reference gene.

Figure 1. The diarrhoea incidences of weanling pigs fed with Control, ZnO or C-ZnO diets for 21 days. Results are means ± SEM, n = 3. Bars without a common letter differ significantly (P < .05). Diarrhoea incidence (%) = number of pigs on a treatment with diarrhoea × diarrhoea days/(total number of pigs × 21 days) × 100%. Control, basal diet without ZnO supplemented; ZnO, diet supplemented with 2250 mg/kg ZnO, C-ZnO, diet supplemented with 562.5 mg/kg coated-ZnO.

Figure 2. Plasma d-lactate level (μg/mL) and diamine oxidase activity (U/mL) of weanling pigs fed with Control, ZnO or C-ZnO diets for 21 days. Results are means ± SEM, n = 6. Bars without a common letter differ significantly (P < .05). Control, basal diet without ZnO supplemented; ZnO, diet supplemented with 2250 mg/kg ZnO, C-ZnO, diet supplemented with 562.5 mg/kg coated-ZnO.

Figure 3. Representative haematoxylin and eosin-stained morphology and villus height, crypt depth and villus height:crypt depth ratio in jejunum of weanling pigs fed with Control, ZnO or C-ZnO diets for 21 days. Results are means ± SEM, n = 6. Bars without a common letter differ significantly (P < .05). Control, basal diet without ZnO supplemented; ZnO, diet supplemented with 2250 mg/kg ZnO, C-ZnO, diet supplemented with 562.5 mg/kg coated-ZnO.

Figure 4. Gel electrophoresis of 18S rRNA, E-cadherin, occludin, and ZO-1 PCR products and expression patterns of E-cadherin, occludin, and ZO-1 mRNA of jejunal mucosa in weanling pigs fed with Control, ZnO or C-ZnO diets for 21 days. Results are means ± SEM, n = 6. Bars without a common letter differ significantly (P < .05). Control, basal diet without ZnO supplemented; ZnO, diet supplemented with 2250 mg/kg ZnO, C-ZnO, diet supplemented with 562.5 mg/kg coated-ZnO. 18S served as endogenous reference gene.

Figure 5. Jejunal mucosa antioxidant indices of weanling pigs fed with Control, ZnO or C-ZnO diets for 21 days. Results are means ± SEM, n = 6. Bars without a common letter differ significantly (P < .05). Control, basal diet without ZnO supplemented; ZnO, diet supplemented with 2250 mg/kg ZnO, C-ZnO, diet supplemented with 562.5 mg/kg coated-ZnO. Units for total antioxidant capability (T-AOC), total superoxide dismutase (SOD), catalase (CAT) are U/mg protein. Unit for malondialdehyde (MDA) is nmol/mg protein Control ZnO C-ZnO.

Figure 6. TUNEL-stained epithelial cells in jejunal mucosa and calculated apoptotic index of weanling pigs fed with Control, ZnO or C-ZnO diets for 21 days. Results are means ± SEM, n = 6. Bars without a common letter differ significantly (P < .05). Control, basal diet without ZnO supplemented; ZnO, diet supplemented with 2250 mg/kg ZnO, C-ZnO, diet supplemented with 562.5 mg/kg coated-ZnO.