Comparison of two probiotic preparations on growth performance, intestinal microbiota, nutrient digestibility and cytokine gene expression in broiler chickens

Figures & data

Table 1. Ingredients and nutrient composition of basal diets^a.

Item	Starter (1–10d)	Grower (11–24d)	Finisher (25–44d)
Ingredient (%)
Corn	50.84	54.86	59.82
Soybean meal	41.86	37.93	32.73
Corn oil	3.09	3.40	3.96
Dicalcium Phosphate	1.72	1.53	1.35
Calcium carbonate	1.07	0.98	0.90
Salt	0.25	0.25	0.24
Sodium bicarbonate	0.15	0.15	0.16
Vitamin–mineral premix^b	0.25	0.25	0.25
Mineral premix^c	0.25	0.25	0.25
DL-methionine	0.24	0.20	0.18
L-lysine HCl	0.16	0.11	0.10
L-Threonine	0.09	0.05	0.03
Calculated Nutrient content
AME (Kcal/Kg)	2900	3000	3100
Crude protein %	22.23	20.81	18.89
Available phosphorus %	0.46	0.42	0.38
Calcium %	0.93	0.84	0.76
Na %	0.15	0.15	0.15
DCAB meq/Kg	256	244	221
Lys (dig) %	1.24	1.11	0.99
Met (dig) %	0.55	0.49	0.45
Met + Cys (dig) %	0.92	0.84	0.77
Thr (dig) %	0.83	0.75	0.66
Analyses Nutrient content
Dry matter (DM, %)	89.4	89.4	89.3
Crude protein %	22.20	20.78	18.88
Crud fat %	4.88	5.18	5.79
Crude fibre %	4.11	3.90	3.65

^aThe bacterial strain was added at the starter, grower and finisher basal diets at 0.5 g/kg diet.

^bVitamin premix supplied the followings per kg of diet: vitamin A, 9000 IU; vitamin D₃, 2000 IU; vitamin E, 36 mg; vitamin K₃, 2 mg; vitamin B₁, 1.75 mg; vitamin B₂, 6.6 mg; vitamin B₆, 2.94 mg;

vitamin B₁₂, 0.015 mg; nicotinic acid, 29.7 mg; folic acid, 1 mg.

^cMineral premix supplied the followings per kg of diet: calcium pantothenate, 9.8 mg; choline chloride, 250 mg; Mn, 99.2 mg; Zn, 84.7 mg; Cu, 10 mg; Fe, 50 mg; Se, 0.2 mg; I, 0.99 mg.

Table 2. Presence of the bacteria in the feed at the end of the experiment (44 d).

	Culture medium
	Nutrient agar	Brain heart agar
Bacillus subtilis (CFU/g)	4 × 10^7	1.13 × 10^7
Bacillus licheniformis (CFU/g)	1.29 × 10^9	6.2 × 10^8

Table 3. Chicken GAPDH and cytokine primer sequences.

Gene^a	Primer sequence^b (5`-3`)	Tm	Ref	Amplicon
IL-10	F:CGGGAGCTGAGGGTGAA	58	NM_001004414.2	272
	R:GTGAAGAAGCGGTGACAGC	60
IFN-γ	F: CAACTTGTTTGTTCTGTCTGTCATC	60	NM_205149.1	185
	R:TTCTCATTTCTCTCTGTCCAGTTCT	60
IL6	F:CCAGAAATCCCTCCTCGCCAATC	60	NM_204628.1	110
	R:CCCTCACGGTCTTCTCCATAAACG	60
GAPDH	F:CTTTGGCATTGTGGAGGGTC	60	NM_204305.1	128
	R:ACGCTGGGATGATGTTCTGG	60

^aGAPDH = Glyceraldehyde-3-phosphate dehydrogenase; IL = interleukin; IFN = interferon.

^bF = Forward primer; R = Reverse primer.

Table 4. Effect of B. subtilis and B. licheniformis on body weight gain, feed intake, and feed conversion ratio of broilers.

	Treatment^A
	C	B.S	B.L	SEM^1	P-Value
First week
BWG (g/bird)	122.06	116.65	116.30	2.041	0.114
FI (g/bird)	143.83^ab	138.65^b	149.25^a	1.93	0.005
FCR (g/g)	1.17^b	1.18^b	1.28^a	0.02	0.013
Second week
BWG (g/bird)	212.30	216.01	216.13	4.99	0.828
FI (g/bird)	304.00	296.68	296.48	10.03	0.835
FCR (g/g)	1.42	1.36	1.37	0.042	0.584
Third week
BWG (g/bird)	297.30	297.21	303.60	5.78	0.676
FI (g/bird)	441.70	430.68	437.33	4.72	0.281
FCR (g/g)	1.48	1.44	1.43	0.029	0.498
Forth week
BWG (g/bird)	421.77	417.65	450.40	10.42	0.0843
FI (g/bird)	736.20	721.68	765.72	12.16	0.0605
FCR (g/g)	1.74	1.72	1.70	0.049	0.847
Fifth week
BWG (g/bird)	546.50^b	553^b	644.90^a	19.40	0.0025
FI (g/bird)	989.75	940.75	989.15	24.963	0.289
FCR (g/g)	1.77^a	1.70^a	1.53^b	0.035	0.0001
Sixth week
BWG (g/bird)	614.05	619.90	653.90	11.04	0.2866
FI (g/bird)	1122.75	1108.15	1141.25	15.02	0.3032
FCR (g/g)	1.86	1.80	1.75	0.048	0.302
Whole period
BWG (g/bird)	2427.45^b	2407.20^b	2580.70^a	51.81	0.0420
FI (g/bird)	3735.61	3641.68	3768.02	43.50	0.1121
FCR (g/g)	1.54^a	1.51^ab	1.46^b	0.020	0.0207
PEF^2	374.49^b	377.51^b	418.95^a	12.487	0.0246

^a-bMeans within rows with no common letters are significantly different at P < 0.05.

^AC, Control; B.S, Bacillus subtilis; B.L, Bacillus licheniformis.

¹Standard error of means.

²production efficiency factor.

Table 5. Effect of B. subtilis and B. licheniformis on the feed cost per kilogram weight gain and return on investment (1–44 d).

Treatment^A	Feed cost per kg gain ($)	Return on investment (ROI)
C	0.48^b	1.24^b
B.S	0.64^a	1.26^b
B.L	0.45^c	1.36^a
SEM^1	0.004	0.033
P-Value	0.0001	0.0238

^a-b-cMeans within a column with no common letters are significantly different at P < 0.05.

^AC, Control; B.S, Bacillus subtilis; B.L, Bacillus licheniformis.

¹Standard error of means.

Table 6. Effect of B. subtilis and B. licheniformis on the relative weight of digestive organs and gastrointestinal tract pH in broilers.

	Relative weight organ^1				gastrointestinal tract pH
Treatment^A	proventriculus	gizzard	Liver		proventriculus	gizzard	ileum	ceca
C	0.356	1.522	1.796		3.116	2.802	6.964^a	6.531
B.S	0.346	1.436	1.792		3.168	2.848	6.600^b	6.461
B.L	0.339	1.411	1.847		3.109	2.879	6.297^b	6.612
SEM^2	0.011	0.035	0.051		0.128	0.113	0.127	0.059
P-Value	0.565	0.082	0.699		0.939	0.890	0.002	0.209

^a-bMeans for probiotic main effect within a column with different superscripts are different at P < 0.05.

^AC, Control; B.S, Bacillus subtilis; B.L, Bacillus licheniformis.

¹Expressed as percent of live weight.

²Standard error of means.

Table 7. Effect of B. subtilis and B. licheniformis on microflora in the ileum of broilers (log CFU/g).

Treatment^A	C	B.S	B.L	SEM^1	P-Value
Lactobacillus	7.083	7.404	7.673	0.223	0.184
Total aerobic bacteria	6.358	6.220	6.845	0.209	0.603
Coliforms	5.389	5.911	5.845	0.488	0.713
Enterobacteriaceae	5.481	6.173	6.109	0.390	0.392
Clostridium perfringens.	2.268	2.046	2.113	0.261	0.819
Yeast and Mold	3.581	3.088	3.888	0.242	0.088

^AC, Control; B.S, Bacillus subtilis; B.L, Bacillus licheniformis.

¹Standard error of means.

Table 8. Effect of B. subtilis and B. licheniformis on ceca microflora in broilers (log CFU/g).

Treatment^A	C	B.S	B.L	SEM^1	P-value
Lactobacillus	8.339	8.313	8.355	0.223	0.990
Total aerobic bacteria	7.827	7.781	7.960	0.273	0.877
Coliforms	7.534	7.596	7.381	0.238	0.799
Enterobacteriaceae	7.604	7.924	7.785	0.184	0.458
Clostridium perfringens.	3.672	3.827	3.289	0.401	0.665
Yeast and Mold	3.846	4.425	4.281	0.273	0.331

^AC, Control; B.S, Bacillus subtilis; B.L, Bacillus licheniformis.

¹Standard error of means.

Table 9. Apparent Ileal and total tract nutrient digestibility in broilers.

Treatment^A	C	B.S	B.L	SEM^1	P-value
Ileal digestibility %
CP	74.62	75.94	76.00	1.130	0.8300
GE	65.64	69.00	72.42	2.121	0.1325
Ca	19.28	20.72	27.63	1.130	0.3830
P	35.12	36.16	39.74	3.673	0.6607
Total tract digestibility %
CP	56.70^b	63.31^a	60.58^a	1.260	0.0030
Ca	20.88	20.94	29.10	2.447	0.0658
P	30.47	35.51	31.51	2.185	0.2762
AME (Kcal/kg)	2820.59^b	2992.88^a	2970.19^a	21.153	0.0002

Note: Means within rows with no common letters are significantly different at P < 0.05.

^AC, Control; B.S, Bacillus subtilis; B.L, Bacillus licheniformis.

¹Standard error of means.

Figure 1. Effect of B. subtilis and B. licheniformis on the gene expression of IL6 (A), INF- gamma (B), and IL10 (C) in the blood plasma (n = 36) of broilers at 42 d of age. Each bar on the graph shows a treatment mean ± SEM.