Evaluation of dietary Pancreatin as an exogenous enzyme on growth performance, gene expression, immunological responses, serum immunoglobins, and intestinal morphology in cockerels

Figures & data

Table 1. Composition and nutrient levels of the basal diet.

Items	Starter (1-42 d)^1	Grower (42-70 d)^1
Ingredients (%)
Maize	66.10	66.25
Soybean	29.00	26.10
Wheat bran	0.20	3.00
Methionine	0.20	0.20
Lysine	0.20	0.15
Salt	0.30	0.30
Limestone	1.30	1.30
CaHPO3	1.70	1.70
Premix^2	1.00	1.00
Calculated Analysis, %
Metabolizable energy, (MJ/kg)	11.98	11.85
Crude protein	18.40	17.48
Crude fiber	2.78	2.80
Calcium	1.08	1.07
Total phosphorus	0.67	0.68
Available phosphorus	0.42	0.43
Lysine	1.13	1.01
Methionine	0.47	0.45

¹ Pancreatin was supplemented at 0, 250, 500, 750, and 1000 mg/kg on the Control diet (CD).

² The premix was sourced from the Yangzhou University Feed Company (Yangzhou, China). The premix contained both Vitamin and trace mineral which per kg of feed contained the following: vitamin A 5000 IU; vitamin D3 1500 IU; vitamin E 10 IU; vitamin K3 8 mg; vitamin B1 8 mg; vitamin B2 3 mg; vitamin B6 15mg; vitamin B12 9 mg; biotin 0.2 mg; folic acid 0.001 mg; choline 5.7 mg; pantothenic acid 45 mg; niacinamide 50 mg; Iron 80 mg; zinc 40 mg; manganese 60 mg; iodine 0.35 mg; Copper 8 mg; selenium 0.15 mg; retinol, 1200,000 IU; cholecalciferol, 400,000 IU; α-tocopherol, 1,800 IU; 2-methyl-1,4-naphthoquinone, 150 mg; thiamine, 90 mg; riboflavin, 800 mg; pyridoxine, 320 mg; cobalamin, 1 mg.

Table 2. Primer pairs for β-actin, IL-2 and IgM genes from birds.¹

Target Gene^2	Gene Sequences (5’–3’)	Length of fragment (base pair)	Gene Code
β-actin	F: GAACAACTGAACGGCAACCA	183	NC_006101.5
	R: ATACCTCTTTTGCTCTGGGCTT
IL-2	F: CAGTGTTACCTGGGAGAAGTGG	58	NC_006091.5
	R: GCTTCACAGATCTTGCATTCACT
IgM	F: GAACAACTGAACGGCAACCA	158	NC_006091.5
	R: TGTGACCGATTGGCTTTGG

¹ Primers were designed with the Primer Premier 5.0 software design.

² IL-2; interleukin-2, β-actin; Beta actin; IgM; immunoglobin M.

Table 3. Effect of supplemented Pancreatin on growth performance.¹

Items	CD^2	Dietary Pancreatin level (mg/kg)					P-Value
		250	500	750	1000	SEM^2	Pancreatin	Linear	Quadratic
live bodyweight (g/bird)
1d	39.34	39.35	39.49	39.83	39.55	0.11	0.679	0.289	0.965
42d	532.34	540.2	557.51	541.51	545.72	4.36	0.573	0.264	0.360
70d	1032.57	1081.87	1093.00	1054.67	1047.67	11.92	0.644	0.790	0.161
1–42 d
ADFI (g)	30.91	30.91	31.14	31.04	31.34	0.17	0.942	0.474	0.784
ADG (g)	11.75	11.94	12.19	12.19	12.05	0.10	0.584	0.274	0.361
FCR (g/g)	2.63	2.60	2.53	2.55	2.60	0.002	0.356	0.311	0.151
42–70 d
ADFI (g)	63.30	65.23	65.61	65.36	64.67	0.40	0.389	0.211	0.116
ADG (g)	17.85	19.32	19.13	17.96	17.94	0.38	0.615	0.864	0.167
FCR (g/g)	3.57	3.43	3.47	3.67	3.62	0.06	0.749	0.561	0.388
1–70 d
ADFI (g)	43.87	44.64	44.93	44.77	44.67	0.27	0.656	0.238	0.340
ADG (g)	14.19	14.89	15.05	14.50	14.40	0.17	0.643	0.797	0.161
FCR (g/g)	3.10	3.02	2.99	3.10	3.11	0.03	0.673	0.840	0.200

¹ Data represent mean values of 6 replicates per treatment (16 birds per pen).

² SEM: standard error of the mean; CD: Control diet; ADFI: average daily feed intake; ADG: average daily gain; FCR: feed conversion ratio.

Table 4. Effect of Pancreatin enzyme supplementation on intestinal morphology of birds.¹

Items	CD^2	Dietary Pancreatin level (mg/kg)					P-Value
		250	500	750	1000	SEM^2	Pancreatin	Linear	Quadratic
42 d
Duodenum (μm)
Villus height	1475.18	1540.28	1525.82	1593.27	1539.25	28.27	0.778	0.336	0.621
Crypt depth	187.42	215.65	217.65	202.90	187.18	5.33	0.193	0.973	0.016
Villus: Crypt ratio	8.47	7.28	7.19	8.15	8.41	0.25	0.304	0.942	0.042
Jejunum (μm)
Villus Height	853.67^a	932.84^ab	1081.27^b	907.11^a	878.80^a	26.40	0.051	0.605	0.020
Crypt Depth	165.31	174.63	194.95	167.29	148.74	6.53	0.263	0.33	0.205
Villus: Crypt ratio	5.16	5.34	5.55	5.42	5.95	0.17	0.297	0.287	0.269
70 d
Duodenum (μm)
Villus Height	1321.14	1351.75	1410.79	1292.46	1281.55	28.74	0.637	0.458	0.253
Crypt Depth	246.06	282.62	300.92	255.88	267.32	6.89	0.087	0.701	0.035
Villus: Crypt ratio	5.37	4.78	4.69	5.29	4.94	0.15	0.611	0.495	0.390
Jejunum (μm)
Villus Height	1579.81	1642.78	1546.24	1492.73	1612.26	28.31	0.506	0.714	0.829
Crypt Depth	262.54	304.33	325.49	307.64	297.27	7.62	0.113	0.090	0.041
Villus: Crypt ratio	6.19	5.45	4.97	5.06	5.57	0.16	0.113	0.081	0.051

^{a, b} Means within a row without common superscripts differ at P < 0.05.

¹ Data represent mean values of 6 replicate per treatment (2 birds per pen).

² SEM: standard error of the mean; CD: Control diet.

Table 5. Effect of different added levels of Pancreatin on intestinal pH of birds.¹

Parameters	CD^2	Dietary Pancreatin level (mg/kg)						P-Value
		250	500	750	1000	SEM^2	Pancreatin	Linear	Quadratic
42 d
Duodenum	7.03	6.99	7.04	6.90	7.03	0.020	0.213	0.477	0.579
Jejunum	6.65	6.64	6.83	6.51	6.67	0.041	0.207	0.820	0.559
70 d
Duodenum	6.81	6.76	6.76	6.68	6.73	0.019	0.321	0.079	0.645
Jejunum	6.59	6.58	6.58	6.42	6.50	0.024	0.094	0.055	0.679

¹ Data represent mean values of 6 replicate per treatment (2 birds per pen).

² SEM: standard error of the mean; CD: Control diet.

Table 6. Effects of Pancreatin supplements on serum immunoglobulins of birds.¹

Parameters		Dietary Pancreatin level (mg/kg)						P-Value
	CD^2	250	500	750	1000	SEM^2	Pancreatin	Linear	Quadratic
42 d
IgA (mg/L)	74.18^c	53.52^ab	73.89^c	58.79^b	45.37^a	1.96	< 0.01	< 0.01	0.147
IgG (mg/L)	405.04^c	305.45^ab	404.72^c	330.06^b	270.64^a	10.6	< 0.01	< 0.01	0.261
IgM (mg/L)	67.77^b	72.20^bc	91.24^d	78.62^c	59.73^a	1.80	< 0.01	0.733	< 0.01
70 d
IgA (mg/L)	65.87^ab	62.57^a	72.67^b	63.60^a	63.15^a	1.16	0.031	0.619	0.256
IgG (mg/L)	376.67^a	362.93^a	428.82^b	382.35^a	385.68^a	6.07	0.006	0.317	0.294
IgM (mg/L)	112.06^a	129.33^b	155.13^c	161.97^c	123.82^ab	3.35	< 0.01	< 0.01	< 0.01

^{a, b, c, d} Means within a row without common superscripts differ at P < 0.05.

¹ Data represent mean values of 6 replicate per treatment (2 birds per pen).

² SEM: standard error of the mean; CD: Control diet.

Table 7. Immunological test response on Ab titers (log2) against NDV at 35 d.¹

Parameters	CD^2	Dietary Pancreatin level (mg/kg)						P-Value
		250	500	750	1000	SEM^2	Pancreatin	Linear	Quadratic
NDV Ab titer	2.64	2.31	2.53	2.04	2.30	0.07	0.078	0.042	0.568

¹ Data represent mean values of 6 replicate per treatment (2 birds per pen).

² SEM: standard error of the mean; CD: Control diet; Ab: Antibodies; NDV: Newcastle disease virus.

Table 8. 70 d spleen gene expression and enzyme activity of birds fed Pancreatin supplement diets.¹

Parameters		Dietary Pancreatin level (mg/kg)						P-Value
	CD^2	250	500	750	1000	SEM^2	Pancreatin	Linear	Quadratic
Spleen gene expression
IL- 2	1.62	1.44	1.20	1.13	1.09	0.09	0.403	0.057	0.875
IgM	2.36	2.23	1.88	1.67	1.44	0.18	0.503	0.086	0.711
Duodenal enzyme activity (U/g)
Trypsin	4.96	4.58	4.48	4.57	4.54	0.14	0.841	0.403	0.459
Chymotrypsin	1.81	1.86	1.85	1.74	1.91	0.03	0.532	0.706	0.797

¹Data represent mean values of 6 replicate per treatment (2 birds per pen).

²SEM: standard error of the mean; CD: Control diet.