Prevalence of Dichelobacter nodosus and Fusobacterium necrophorum on dairy farms in Slovakia

Figures & data

Table 1. Primer sequention for Dichelobacter nodosus (16S rRNA).

Primer	Name	Sequency (5´–3´)
forward	D.N.16SrRNA_F	GCTAAGGAAAAAGCACCGGC
reverse	D.N.16SrRNA_R	GTTTGCTACCCACGCTTTCG

Table 2. Primer sequention for Fusobacterium necrophorum (lktA).

Primer	Name	Sequency (5´–3´)
forward	F.N.lktA_F	TTTTGGAGTCGGAGTCGCAG
reverse	F.N.lktA_R	CTCCGGCTGCAAGAATTCCA

Figure 1. The PCR product of lktA F. necrophorum generated from field samples. L – Ladder 50 bp, K+ – positive control, K− – negative control with qH2O. Column 1–3 samples for F. necrophorum, column 1- the method of freezing and boiling from PBS is negative, lane 2 – the method of freezing and boiling from AB is positive, lane 3 – the method with high pure PCR template preparation kit is negative.

Figure 2 .#Prevalence of D. nodosus and F. necrophorum in dairy cows

Table 3. Numbers and frequencies (%) of dairy cows positive for D. nodosus and F. necrophorum.

Farm	No of cows	D. nodosus	%	F. necrophorum	%
F1	262	224^a	85.5	113^a	43.1
F2	218	109^b	50	0^b	0
F3	231	231^c	100	0^c	0
F4	150	150^ca	100	10^a	6.7
F5	310	300^c	96.8	140^a	45.2
F6	200	200^c	100	100^b	50.0
F7	150	80^b	53.3	0^b	0
F8	110	100^a	90.9	10^c	9.1
Total	1,631	1,394	85.5	373	22.1

^a,b,c Within a column, numbers without a common superscript differed (p < 0.05)

Table 4. Numbers and frequencies (%) of dairy cows positive for D. nodosus and F. necrophorum in regions.

Region	No of cows	D. nodosus	%	F. necrophorum	%
East Slovakia (F1,F2,F3)	711	564^a	79.3	113^a	16
West Slovakia (F4,F5)	460	450	97.8	150^b	32.6
Middle Slovakia (F6,F7,F8)	460	380^a	83	110^ab	24.2

^a Within a column, numbers without a common superscript differed (p < 0.05)

Figure 3. Effect plot of the interaction milk yield x F. necrophorum positivity. Milk yield (kg): natural logarithm.

Figure 4. Effect plot of the interaction milk yield x D. nodosus positivity. Milk yield (kg): natural logarithm.

Table 5. The multinomial logistic regression model for the association of presence of bacteria and the final model variables in 1,631 Slovak dairy cows.

Bacterium	n	OR^a	p-value	95% CI^b
D. nodosus	1,394
Log kg (milk/year)		0.69	<0.05	0.49–0.95
F. necrophorum and Log kg^c		2.37	<0.05	1.07–4.82
F. necrophorum	373
Log kg (milk/year)		0.32	<0.05	0.19–1.03
F. nodosus and Log kg^c		4.55	<0.05	1.39–14.52

OR^a= odds ratio

95% CI^b = 95% confidence interval