Influence of zinc sulfate and threonine supplementation on mucin 5ac gene expression in the small intestine and intestinal mucosal morphology in broiler chickens

Figures & data

Table 1. Percent diet composition and nutrient levels of standard diets (as-fed basis).

Ingredients (%)	Starter (0-21 days)	Finisher (22-42 days)
Corn (8.5% CP)	57.16	61.27
Soybean meal (43% CP)	36.68	31.37
Soybean oil	2.07	3.44
Limestone	1.20	1.32
CaHPO4	1.67	1.56
NaCl	0.29	0.27
L-Lys·HCl (99%)	0.21	0.18
DL-Met (98%)	0.21	0.14
Choline Chloride (50%)	0.26	0.20
Vitamin premix^1	0.05	0.05
Mineral premix^2	0.20	0.20
Total	100.00	100.00
Nutrient levels (%)
Crude protein	21.0	19.0
Metabolizable energy (MJ/kg)	12.13	12.68
Calcium	0.90	0.90
Non-phytate Phosphorus	0.45	0.42
Lysine	1.242	1.095
Methionine	0.537	0.449
Methionine + Cysteine	0.865	0.754
Threonine	0.861	0.774
Zinc	0.00401	0.0040
Tryptophan	0.289	0.256

¹ Vitamin premix provided the following per kilogram of diet: VA (retinyl acetate) 10 000 IU, VD₃ (cholecalciferol) 2 000 IU, VE (DL-α-tocopheryl acetate) 11.0 IU, VK 1.0 mg, VB₁ 1.2 mg, VB₂ 5.8 mg, VB₆ 2.6 mg, VB₁₂ 0.012 mg, niacin 66.0 mg, pantothenic acid (calcium pantothenate) 10.0 mg, biotin 0.20 mg, folic acid 0.70 mg.

² Mineral premix provided the following per kilogram of diet: Mg 100 mg, Zn 75 mg, Fe 80 mg, I 0.65 mg, Cu 8.0 mg, Se 0.35 mg.

Table 2. Primer sequences for real-time PCR assay.

Target genes	Primer sequence F/R	TA (°c)	Length	Gene Bank ID
MUC5AC	F: TGGCTCCTTGTGGCTCCTCAG R: AGCTGACACATGAGGCACATTCAC	78	146	XM_025151099.1
GAPDH	F: CTACACACGGACACTTCAAG R: CGTCTGGTTGAGGATGTGACTC	82	271	NM_204305

T_A: amplification temperature; MUC5AC: Mucine5 AC; GAPDH: Glyceraldehyde-3- phosphate deshydrogenase.

Table 3. Growth performance and relative immune organs weight of broilers at 21 and 42 days of age

Items		T0	T1	T2	T3	SEM	P-Value
Growth performance
Starter (0-21 days)	FI (g/d)	42.15^a	39.35^b	41.73^ab	39.89^ab	0.68	0.027
	ADG (g/d)	27.40^a	25.38^b	27.43^a	26.59^ab	0.27	0.03
	FCR (g/g)	1.54	1.55	1.52	1.50	0.01	0.35
	Body weight (g)	612.84^a	569.97^b	613.04^a	595.70^ab	13.0	0.01
Finisher (22-42 days)	FI (g/d)	127.36	127.60	121.88	125.10	1.33	0.75
	ADG (g/d)	67.93	65.76	66.19	65.76	0.77	0.74
	FCR (g/g)	1.87	1.94	1.84	1.9	0.03	0.43
	Body weight (g)	2039.30	1950.90	2003.10	1976.70	51.0	0.37
Immune organs weight (%)
Starter	Bursa	2.52^a	2.22^ab	2.06^ab	1.95^b	0.10	0.039
	Spleen	0.89	0.93	1.00	1.11	0.05	0.19
Finisher	Bursa	0.84^ab	0.64^b	0.95^a	0.72^ab	0.06	0.035
	Spleen	0.99	1.15	1.04	1.05	0.05	0.76

Abbreviations: FI: Feed intake, ADG: Average Daly Gain, FCR: Feed Conversion Ratio. T₀ (standard diet with no supplementation). T₁ (standard diet supplemented with 40 mg ZnSO4/kg diet). T₂ (standard diet supplemented with 0.2% L-Thr). T₃ (standard diet supplemented with 40 mg ZnSO4/kg diet and 0.2% L-Thr).

^a,b Means in the same row with different superscripts are significant at P < 0.05. SEM: Pooled Standard Error of Means (n = 8).

Figure 1. Clear micrograph of intestinal segments of broilers from different treatments (T₀, T₁, T₂ and T₃). A₁, A₂ and A₃ represent respectively the duodenum, jejunum, and ileum of chickens from treatment T₀. B₁, B₂ and B₃ represent respectively the duodenum, jejunum, and ileum of chickens from treatment T₁. C₁, C₂ and C₃ represent respectively the duodenum, jejunum, and ileum of chickens from treatment T₂. D₁, D₂ and D₃ represent respectively the duodenum, jejunum, and ileum of chickens from treatment T₃.

Table 4. Intestinal morphology of broilers at 21 and 42 days of age.

Items		T0	T1	T2	T3	SEM	P-Value
Starter (0–21 days)
VH	Duodenum	1915.86	1819.66	1948.30	1727.83	53.60	0.98
	Jejunum	755.39^b	1007.232^a,b	1193.40^a	831.43^b	55.30	0.01
	Ileum	553.40^b	770.53^a	668.67^a,b	636.53^a,b	29.95	0.047
CD	Duodenum	149.25	152.87	239.50	152.83	17.10	0.57
	Jejunum	149.17	137.47	141.83	151.47	8.45	0.94
	Ileum	102.53	123.05	118.03	110.38	6.11	0.70
Finisher (22–42 days)
VH	Duodenum	1768.73	1621.30	1743.40	1816.30	6.58	0.82
	Jejunum	1333.80^a,b	1479.40^a	1084.10^b	1233.10^a,b	54.72	0.043
	Ileum	733.60	818.50	808.50	780.20	37.33	0.87
CD	Duodenum	176.20^a,b	201.42^a	165.70^a,b	145.80^b	6.58	0.005
	Jejunum	217.70^a	155.50^b	155.10^b	180.00^a,b	7.82	0.004
	Ileum	176.90	191.70	163.62	157.80	6.55	0.26

Abbreviations: VH: Villi height, CD: Crypt depth. T₀ (control group). T₀ (standard diet with no supplementation). T₁ (standard diet supplemented with 40 mg ZnSO4/kg diet). T₂ (standard diet supplemented with 0.2% L-Thr). T₃ (standard diet supplemented with 40 mg ZnSO4/kg diet and 0.2% L-Thr).

^a,b Means in the same row with different superscripts are significant at P < 0.05. SEM: Pooled Standard Error of Means (n = 8).

Figure 2. Relative mRNA expression levels of mucin 5ac (MUC5AC) in duodenum at 21 d-old (A), duodenum at 42 d-old (B), jejunum at 21 d-old (C), jejunum at 42 d-old (D), ileum at 21 d-old (E) and ileum 42 d-old (F). Values are represented as means and SEM are represented by vertical bars. Means with different superscripts differ significantly (P < 0.05) (n = 8)

Data availability statement

All data used is available and can be provided upon reasonable request.