C-type natriuretic peptide treatment before in vitro maturation enhances maturation of yak oocytes and developmental competence of their crossbred embryos

Figures & data

Table 1. Information of primers used in RT–qPCR.

Genes	Forward primer (5′–3′)	Reverse primer (5′–3′)	Accession no.	Size (bp)
DNMT1	GGTGAAAAGGCTCTTCTTGGC	AATAGTGGTGCGTACTCTGGGC	NM_182651.2	129
BAX	CCACCCTGCAGCAAATTAGC	CCACACTCGGACCACGTCTT	NM_173894.1	92
BCL2	TTGTGGCTTGCTAATAAT	AAACCCCATCCTTTATG	NM_001166486.1	93
BMP15	GGAGGAGAGCACAGAGAAGG	TTCTTGCATTTGCTGGAGAC	NM_001031752.1	139
GDF9	TCTACAACACTGTTCGGCTCTTCA	CACAACAGTAACACGATCCAGGTT	NM_174681.2	154
GAPDH	GAGAAACCTGCCAAGTATGA	CGAAGGTAGAAGAGTGAGTG	NM_001034034.2	139

Table 2. Effect of C-type natriuretic peptide (CNP) pre-IVM on germinal vesicle rate of yak oocytes.

Culture time	No. oocytes	CNP concentrations (nM) in IVM media				Replicates
		0	50	100	200
0	360	83.51 ± 5.04^a,A	79.27 ± 9.18^a,A	83.57 ± 7.73^a,A	81.20 ± 2.73^a,A	3
4	360	65.75 ± 4.76^b,A	73.04 ± 12.29^a,B	80.44 ± 7.33^a,C	73.93 ± 9.23^ab,B	3
6	344	48.61 ± 2.71^c,A	66.61 ± 9.20^a,B	78.15 ± 5.66^a,C	67.06 ± 9.68^b,B	3
8	356	43.5 ± 12.67^cd,A	37.47 ± 6.22^b,B	46.14 ± 1.76^b,A	45.41 ± 8.04^c,A	3
12	360	35.05 ± 8.33^d,A	34.01 ± 7.27^b,A	38.15 ± 5.50^bc,A	38.34 ± 6.08^cd,A	3
16	344	35.96 ± 3.41^de,A	36.12 ± 4.33^b,A	34.61 ± 6.77^c,A	33.77 ± 1.77^cd,A	3
24	364	25.24 ± 2.78^e,A	29.62 ± 1.43^b,A	31.95 ± 6.86^c,A	26.54 ± 6.54^d,A	3

Note: The data are expressed as mean ± standard error and analysed with two-way ANOVA followed by Tukey’s multiple-comparison test. Values with different superscripts (a, b, c, and d) in the same column are significantly different (P < .05). Values with different superscripts (A, B, and C) in the same row are significantly different (P < .05).

Table 3. Maturation rate for 24–28 h IVM after 6 h pre-IVM with C-type natriuretic peptide (CNP).

Duration of IVM	CNP concentrations in pre-IVM (nM)	No. of oocytes	Replicates	Rate of nuclear maturation (%)
				MI	MII
24	0	60	3	21.67 ± 2.88^a	48.33 ± 7.64^b
	50	73	3	20.92 ± 4.78^a	61.52 ± 7.4^ab
	100	66	3	17.59 ± 4.22^a	69.72 ± 1.63^ab
	200	68	3	18.27 ± 4.88^a	55.86 ± 4.5^a
26	0	60	3	21.67 ± 1.67^a	48.33 ± 4.41^c
	50	74	3	17.56 ± 1.24^ab	60.83 ± 0.83^ab
	100	72	3	13.95 ± 1.49^b	68.02 ± 0.74^a
	200	68	3	16.63 ± 0.96^b	55.09 ± 2.71^bc
28	0	60	3	21.67 ± 1.67^a	48.33 ± 4.41^c
	50	72	3	14.07 ± 2.07^b	62.56 ± 0.6^b
	100	63	3	12.68 ± 1.45^b	79.42 ± 0.58^a
	200	65	3	15.4 ± 1.26^b	59.98 ± 0.51^b

Note: The data are expressed as mean ± standard error and analysed with two-way ANOVA followed by Tukey’s multiple-comparison test. Values with different superscripts (a, b, and c) in the same column are significantly different (P < .05).

Table 4. Effects of C-type natriuretic peptide (CNP) concentration in pre-IVM for 6 h on embryo development.

CNP concentrations (nM)	No. of oocytes	Replicates	Cleavage (%)	Blastocyst (%)
0	95	3	47.72 ± 0.35^c	22.80 ± 0.35^b
50	94	3	49.65 ± 0.36^b	22.70 ± 0.35^b
100	92	3	63.76 ± 0.36^a	32.97 ± 0.36^a
200	83	3	47.79 ± 0.40^c	20.48 ± 0.70^c

Note: The data are expressed as mean ± standard error and analysed with one-way ANOVA followed by Tukey’s multiple-comparison test. Values with different superscripts (a, b, and c) in the same column are significantly different (P < .05).

Figure 1. Effect of C-type natriuretic peptide treatment on transzonal projection population of yak oocyte. Phalloidin-FITC average fluorescence intensity in the zona area of COCs: (A) after recovery (0 h IVM), (B) 6 h of conventional IVM (6 h IVM), (C) 6 h pre-IVM with 100 nM CNP (6 h pre-IVM), (D) 24 h conventional IVM (24 h IVM), and (E) 6 h pre-IVM with 100 nM CNP followed by 28 h IVM (6 h pre-IVM + 28 h IVM). (F) Average pixel intensity in the region between the oocyte and cumulus cells was quantified with Image J. At least 10 COCs per group were assessed in four replicates. Each bar represents mean ± standard error and analysed with one-way ANOVA followed by Tukey’s multiple-comparison test. Values with different superscripts (a, b, and c) are significantly different (P < .05).

Figure 2. Effect of C-type natriuretic peptide treatment on GSH and ROS levels of yak oocyte. (A) H₂DCF-DA-ROS average fluorescence intensity per oocyte after 6 h of conventional IVM (6 h IVM), 6 h pre-IVM with 100 nM CNP (6 h pre-IVM), 24 h conventional IVM (24 h IVM), and 6 h pre-IVM with 100 nM CNP followed by 28 h IVM (6 h pre-IVM + 28 h IVM). (B) MCB-GSH average fluorescence intensity per oocyte following IVM. A total of 30 oocytes were assessed per group (3 replicates). Each bar represents mean ± standard error and analysed with one-way ANOVA followed by Tukey’s multiple-comparison test. Values with different superscripts (a, b, and c) are significantly different (P < .01).

Figure 3. Effect of C-type natriuretic peptide (CNP) pre-treatment on gene expression of yak oocyte. After yak oocytes were in vitro matured 0 h (0 h IVM), 24 h conventional IVM (24 h IVM), and 6 h pre-IVM with 100 nM CNP followed by 28 h IVM (6 h pre-IVM + 28 h IVM), the expression levels of BAX, BCL2, DNMT1, GDF9 and BMP15 were detected by RT-qPCR and were presented relative to GAPDH as the mean ± standard error. Values with different superscripts (a, and b) are significantly different (P < .05; one-way ANOVA followed by Tukey’s multiple-comparison test). n = 10 per each group.