Evaluation the effect of dietary vitamin E, sesamin and thymoquinone bioactive compounds on immunological response, intestinal traits and MUC-2 gene expression in broiler Japanese quails (Coturnix japonica)

Figures & data

Table 1. Composition and calculated nutrient content of the experimental broiler quails diets.

Item	Content
Ingredients %
Corn	508.3
Soybean meal	440
Vegetable oil	22
Dicalcium phosphate	9.8
CaCO3	12.2
NaCl	2.3
NaHCO3	1.3
DL-methionine	0.2
L-threonine	0.9
Trace mineral and vitamins premix**	2
Choline chloride	1
Calculated nutrient content
Metabolizable energy (Kcal.kg)	2900
Crude protein (%)	24
Calcium (%)	0.8
Available phosphorus (%)	0.3
Methionine + Cysteine (%)	0.75
Lysine (%)	1.34
Threonine (%)	1.02

*Calculated according to NRC (1994). **Vitamin and mineral provided the following per kg of diet: vitamin A, 1,650 IU; vitamin D3, 750 IU; vitamin E, 12 IU; vitamin K, 1 mg; riboflavin, 4 mg; vitamin B12, 0.003 mg; pantothenic acid, 10 mg; nicotinic acid, 40 mg; folic acid, 1 mg; Mg, 60 mg; Fe, 120 mg; Cu, 5 mg; Zn, 25 mg; I, 0.3 mg.

Table 2. Selected primers for examination the quantitative real-time PCR in boiler quails.

Target gene	Gene bank accession	Forward sequence (5′–3′)	Reverse sequence (5′–3′)
MUC2	NM_001318434	CCACAAGTCCTCCAGTACCTACA	AGGTTTCATAGTCACCACCATCTTC
Beta-actin	NM_205518	CTGGCACCTAGCACAATGAA	CTGGTTGCTGATCCACATCT

Table 3. Effect of treatments on relative lymphoid organ weights of experimental quails.

Treatments	Thymus (%)	Bursa.F (%)	Spleen (%)
Control	0.122^c*	0.158^e	0.116^d
Vitamin E (100 mg)	0.138^b	0.164 ^d	0.119^d
Vitamin E (200 mg)	0.151^a	0.191^c	0.132^b
Sesamin (100 mg)	0.141^b	0.159^e	0.121^c
Sesamin (200 mg)	0.154^a	0.200^b	0.131^b
Thymoquinone (100 mg)	0.142^b	0.161^d	0.124^c
Thymoquinone (200 mg)	0.153^a	0.204^a	0.135^a
SEM	0.021	0.008	0.031

*^a,b,c,dDifferent superscripts letters indicate statistically differences in each column (p ≤ 0.05).

Table 4. Effect of treatments on differences between antibody titrations of experimental quails.

Treatments	NDV*	AI	SRBC	IBV
	(log^2) HI	(log^2) HI	(Ig.G+ Ig.M)	(Ig.G+ Ig.M)
Control	3.7^b**	2.1^b	1.9^b	1892^d
Vitamin E (100 mg)	3.7^b	2.4 ^b	2.1^a	1927^d
Vitamin E (200 mg)	3.8^b	2.8^a	2.2^a	2008^b
Sesamin (100 mg)	4.1^a	2.6	1.9^b	1981^c
Sesamin (200 mg)	4.2^a	2.8^a	2.5^a	2071^a
Thymoquinone (100 mg)	4.3^a	2.6^a	2.1^a	2005^b
Thymoquinone (200 mg)	4.5^a	2.9^a	2.4^a	2120^a
SEM	0.24	0.27	0.41	25.25

*NDV: Newcastle vaccine disease; AI: Avian influenza; SRBC: sheep red blood cell; IB: infectious bronchitis virus antibody. **^a,b,c,dDifferent superscripts letters indicate statistically differences in each column (p ≤ 0.05).

Table 5. Effect of treatments on some erythrocyte profile of experimental quails.

Treatments	RBC*	Hb	PCV	MCV	MCH	MCHC
	(106/UL)	(g/dL)	(%)	(fL)	(Pg)	(g/dL)
Control	3.71	13.5	37.5	109.2	47.7	48.5
Vitamin E (100 mg)	3.92	13.7	38.1	107.6	46.5	47.1
Vitamin E (200 mg)	3.88	13.8	38.6	105.5	44.5	46.2
Sesamin (100 mg)	3.69	13.7	39.9	106.4	47.9	48.5
Sesamin (200 mg)	3.72	13.9	38.3	104.3	46.5	45.2
Thymoquinone (100 mg)	3.89	13.8	39.5	105.2	45.2	43.4
Thymoquinone (200 mg)	3.91	13.9	41.8	102.8	42.7	41.8
SEM	0.19	0.28	3.12	3.76	3.41	4.49

*RBC: red blood cell count; Hb: hemoglobin concentration; PCV: packed cell volume; MCV: mean corpuscular volume; MCH: mean corpuscular hemoglobin; MCHC: mean corpuscular hemoglobin concentration.

Table 6. Effect of treatments on white blood cell and heterophils to lymphocytes ratio of experimental quails.

Treatments	WBC*	Lymphocytes	Heterophils	H. L**
	(103U/L)	(%)	(%)
Control	19.7^d	70.9^b	22.2^a	0.31^a
Vitamin E (100 mg)	19.7^d	71.4^b	21.9^a	0.30^b
Vitamin E (200 mg)	19.8^c	73.1^a	20.1^d	0.28^d
Sesamin (100 mg)	20.1^b	72.4^b	21.6^b	0.29^c
Sesamin (200 mg)	20.2^b	73.2^a	20.8^e	0.28^d
Thymoquinone (100 mg)	20.3^b	72.1^b	21.3^c	0.29^c
Thymoquinone (200 mg)	20.5^a	73.2^a	20.9^e	0.28^d
SEM	0.040	0.511	0.049	0.004

*WBC: white blood cell; H.L: heterophil to lymphocyte ratio. **^a,b,c,dDifferent superscripts indicate statistically differences in each column (p ≤ 0.05).

Table 7. Effect of treatments on liver enzyme activity of experimental quails.

Treatments	ALP*	AST	ALT	Albumen
	(IU/L)	(IU/L)	(IU/L)	(g/dL)
Control	95.1^a**	36.7^a	29.3^a	2.1^a
Vitamin E (100 mg)	94.4^b	36.4^a	28.4^b	1.9^b
Vitamin E (200 mg)	93.9^c	35.6^c	28.1^b	1.7^d
Sesamin (100 mg)	94.4^b	36.3^a	28.3^b	1.8^c
Sesamin (200 mg)	93.4^d	35.1^d	27.5^c	1.7^d
Thymoquinone (100 mg)	94.4^b	35.8^c	28.1^b	1.9^b
Thymoquinone (200 mg)	93.1^d	34.3^d	27.2^c	1.7^d
SEM	0.134	0.141	0.156	0.042

*ALP: alkaline phosphatase; AST: aspartate transaminase; ALT: alanine transaminase. **^a,b,c,dDifferent superscripts indicate statistically differences in each column (p ≤ 0.05).

Table 8. Effect of treatments on serum antioxidant activates of experimental quails.

Treatments	GPX*	CAT	SOD	TAC
	(mU/mL)	(IU/Mg)	(IU/g)	(mM/L)
Control	1.60^e**	4.10^d	1.76^d	0.77^c
Vitamin E (100 mg)	1.65 ^cd	4.19^c	1.85^c	0.80^c
Vitamin E (200 mg)	1.70^b	4.24^c	1.92^b	0.87^b
Sesamin (100 mg)	1.64^d	4.17^c	1.82 ^c	0.86^b
Sesamin (200 mg)	1.71^b	4.40^b	2.10^a	0.92^a
Thymoquinone (100 mg)	1.67^c	4.37^b	1.94^b	0.87^b
Thymoquinone (200 mg)	1.74^a	4.62^a	2.08^a	0.91^a
SEM	0.007	0.002	0.018	0.011

*Gpx: glutathione peroxidase; CAT: catalase; SOD: superoxide dismutase; TAC: total antioxidant capacity. **^a,b,c,dDifferent superscripts letters indicate statistically differences in each column (p ≤ 0.05).

Table 9. Effect of treatments on cell-mediated immunity challenge of experimental quails.

Treatments	DNCB*	PHA
Control	1.65^d**	0.79^a
Vitamin E (100 mg)	1.69^d	0.74^b
Vitamin E (200 mg)	1.81^b	0.72^b
Sesamin (100 mg)	1.73^c	0.75^b
Sesamin (200 mg)	1.92^a	0.70^c
Thymoquinone (100 mg)	1.80^b	0.72^b
Thymoquinone (200 mg)	1.93^a	0.70^c
SEM	0.025	0.015

*DNCB: response of skin to dinitrochlorobenzene; PHA: Wing web swelling by phytohemagglutinin. **^a,b,c,dDifferent superscripts letters indicate statistically differences in each column (p ≤ 0.05).

Table 10. Effect of treatments on intestine microflora population of experimental quails.

Treatments	Salmonella enterica	Escherichia-coli	Lactobacillus	Coliforms
	(Cfu/g)	(Cfu/g)	(Cfu/g)	(Cfu/g)
Control	5.89^a**	5.98^a	5.39^c	7.91^a
Vitamin E (100 mg)	5.78^b	5.89^b	5.41^c	7.82^b
Vitamin E (200 mg)	5.74^b	5.81^b	5.52^b	7.81^b
Sesamin (100 mg)	5.76^b	5.65^c	5.55^b	7.75^b
Sesamin (200 mg)	5.65^bc	5.59^c	5.61^a	7.63^c
Thymoquinone (100 mg)	5.61^bc	5.49^d	5.56^b	7.66^c
Thymoquinone (200 mg)	5.55^c	5.44^d	5.67^a	7.49^d
SEM	0.032	0.065	0.041	0.036

**^a,b,c,dDifferent superscripts letters indicate statistically differences in each column (p ≤ 0.05).

Table 11. Effect of treatments on histomorphological analysis and MUC₂ mRNA gene expression of experimental quails.

Treatments	Crypt Depth	Villus Height	Villus Surface	Goblet Cell Density	Goblet Cell Density	MUC2 mRNA gene expression
	(µm)	(µm)	(µm)	(AB*)	(PAS)
Control	134.9^cd	588.2^d**	0.583^d	11.02^d	10.81^d	2.35^d
Vitamin E (100mg)	133.5^d	604.4^c	0.608^c	11.09^cd	11.06^bc	2.49^c
Vitamin E (200mg)	136.9^bc	630.3^a	0.627^b	11.29^b	11.15^b	2.71^a
Sesamin (100mg)	133.8^d	610.2^bc	0.612^c	11.14^c	11.05^c	2.53^bc
Sesamin (200mg)	138.3^ab	637.7^a	0.646^a	11.39^a	11.26^a	2.61^b
Thymoquinone (100mg)	133.9^d	615.2^b	0.625^b	11.10^c	11.06^bc	2.45^c
Thymoquinone (200mg)	139.7^a	634.3^a	0.647^a	11.35^ab	11.31^a	2.78^a
SEM	2.08	2.52	0.003	0.025	0.034	0.032

*Goblet cell density acid mucin by alcian blue; PAS: periodic Acid-Schiff-stained neutral mucin. **^a.b.c.dDifferent superscripts letters indicate statistically differences in each column (p ≤ 0.05).

Data availability statement

All data presented in this study will available free of charge for any researcher upon reasonable request from the corresponding author.