Prevalence of growth hormone receptor gene polymorphisms and their association with milk production and fertility-related traits of cross-bred dairy cows in Sri Lanka

Figures & data

Table A1. Primers used for PCR and sequencing of bovine GHR gene fragments.

Targeted region	Length of the amplified fragment	Primers (5’- 3’)
Exon 08	354 bp	F - AGGAAGTTTTATGTGGAACAGGAG
		R – ACCTGTGTTGTCTCTCTGTGG
5’ UTR	211 bp	F – TTGACCCTTGAACAAAATGGG
		R – CCTGACTCCTGCCTTCTTCAA

F: Forward; R: Reverse.

Table A2. Genotypic and allelic frequencies of SNPs in GHR gene of screened cross-bred dairy cattle population in Sri Lanka (n = 118 for GHR 5’ UTR fragment and n = 153 for exon 08 fragment).

Region	SNP	Presence in tested population	Nucleotide change	Genotypic frequencies (number of cows in each genotype)	Allelic frequencies
					Major allele frequency	Minor allele frequency
5’ UTR	rs109014416	Yes	G→T	GG = 0.136 (16) GT = 0.127 (15) TT = 0.737 (87)	T = 0.801	G = 0.119
	rs109231659	Yes	G→T	GG = 0.788 (93) GT = 0.136 (16) TT = 0.076 (9)	G = 0.856	T = 0.114
	rs134115846	Yes	A→G	AA = 0.356 (42) AG = 0.305 (36) GG = 0.339 (40)	A = 0.508	G = 0.492
Exon 08	rs385640152	Yes	T→A	TT = 0.987(151) TA = 0.007 (1) AA = 0.007 (1)	T = 0.990	A = 0.010

Table A3. Association between different genotypes of detected SNPs in GHR gene 5’ UTR fragment and fertility traits.

SNP	Genotype	Services per conception	Age at first calving (days)	Average calving interval (days)
rs109014416	GG	1.61±0.25	918.51^a±113.42	534.41^a±43.29
	GT	1.17±0.31	1212.89^b±88.22	364.52^b±54.01
	TT	1.76±0.14	1275.18^b±38.31	515.09^a±24.49
rs109231659	GG	1.73±0.14	1264.09±40.62	484.76±21.72
	GT	1.45±0.28	1127.49±91.82	549.87±43.79
	TT	1.36±0.31	1121.11±103.20	362.64±49.42
rs134115846	AA	1.55±0.22	1255.80±55.51	470.67±39.15
	AG	1.70±0.23	1259.33±106.64	496.62±42.07
	GG	1.45±0.20	1141.50±52.90	507.12±36.47

All the data in the table are least-square means ± S.E. ^a,b Different superscripts within the same column demonstrate significant differences at P < 0.05.

Table A4. Association between different genotypes of detected SNPs in GHR 5’ UTR gene fragment and milk production-related traits.

SNP	Genotype	Average milk yield (L/day)	Average lactation length (days)	Average total lactation milk yield (L)
rs109014416	GG	6.01±0.65	272.36±29.60	1537.04±324.62
	GT	4.37±0.82	226.58±34.69	1519.23±380.39
	TT	5.46±0.37	280.35±15.39	1737.20±168.76
rs109231659	GG	5.52±0.37	271.68±16.41	1623.42±175.35
	GT	6.09±0.45	278.38±30.58	1761.47±326.71
	TT	8.12±0.84	242.96±40.87	1894.00±436.73
rs134115846	AA	6.20±0.55	284.51±23.14	1841.22±244.54
	AG	5.61±0.59	284.34±34.00	1837.76±268.17
	GG	5.17±0.52	263.79±21.55	1672.57±227.75

All the data in the least-square means ± S.E.

Availability of data and material

The datasets utilized and analyzed in this study are available upon reasonable request from the corresponding author.