Association analysis of the sorting nexin 29 (SNX29) gene copy number variations with growth traits in Diannan small-ear (DSE) pigs

Figures & data

Table 1. Details of primers used for pig SNX29 CNV detection in this study.

Gene	Pairs Sequence (5′-3′)	qPCR Amplification Length (bp)	Tm (°C)
SNX29-CNV 10810	F:CTCTGAGCGTCCCTCTTCT	178	60
	R:GCTTCTACCTGCCTCTTCA
SNX29-CNV 10811	F:ATCATGGCTCAGTGGAAAT	105	60
	R:AGTGCGTATGGAACCTACA
GCG	F:GAATCAACACCATCGGTCAAAT	147	60
	R:CTCCACCCATAGAATGCCCAGT

Note: F: forward primer; R: reverse primer.

Figure 1. Distribution of different SNX29 CNV types in CNV10810 and CNV10811 in the 415 DSE pigs.

Table 2. Association analysis of SNX29 CNV10810 and growth traits in DSE pigs.

Age	Growth Trait	CNV Type (Mean ± SE)			P-Value
		Normal(n = 164)	Loss(n = 38)	Gain(n = 213)
12th month	BW(kg)	34.56 ± 1.44	38.53 ± 2.14	34.69 ± 0.98	0.16
	BOH(cm)	46.74 ± 0.63	48.21 ± 1.20	46.27 ± 0.62	0.25
	BL(cm)	83.54 ± 1.31	80.70 ± 1.78	82.62 ± 1.04	0.14
	BAH(cm)	78.18 ± 1.32	83.21 ± 2.20	78.76 ± 1.03	0.07
	CC(cm)	45.49 ± 0.61	46.62 ± 1.24	46.48 ± 0.65	0.54
	CBC(cm)	92.73 ± 2.87	92.06 ± 2.47	87.48 ± 1.53	0.42
	AC(cm)	12.28 ± 0.19	12.41 ± 0.19	12.13 ± 0.16	0.59
	BF(mm)	22.85 ± 0.84 ^b	25.26 ± 1.00 ^a	23.07 ± 0.64 ^a,b	0.04*
15th month	BW(kg)	43.05 ± 1.00	44.48 ± 2.05	44.02 ± 0.98	0.73
	BOH(cm)	48.56 ± 0.56	49.06 ± 0.75	49.81 ± 0.50	0.24
	BL(cm)	90.16 ± 0.86 ^ab	85.40 ± 4.28 ^b	91.59 ± 0.75 ^a	0.05*
	BAH(cm)	86.43 ± 0.93	83.36 ± 4.52	87.13 ± 0.99	0.69
	CC(cm)	47.04 ± 0.58	47.77 ± 0.71	48.39 ± 0.49	0.19
	CBC(cm)	93.55 ± 2.39	96.85 ± 1.97	96.47 ± 0.99	0.37
	AC(cm)	12.66 ± 0.10	12.71 ± 0.18	12.76 ± 0.12	0.83
	BF(mm)	22.98 ± 0.93 ^b	25.37 ± 1.04 ^a	23.04 ± 0.82 ^ab	0.01*

Notes: Values with different letters (a,b) within the same row represent significant differences among the three groups. (*P < 0.05).

Table 3. Association analysis of SNX29 CNV10811 and growth traits in DSE pigs.

Age	Growth Trait	CNV Type (Mean ± SE)			P-Value
		Normal(n = 131)	Loss(n = 70)	Gain(n = 214)
6th month	BW(kg)	18.54 ± 0.64^b	22.86 ± 0.84^a	23.00 ± 1.81 ^a	0.00**
	BOH(cm)	36.68 ± 0.56	39.22 ± 1.63	36.63 ± 0.70	0.16
	BL(cm)	68.16 ± 1.13	71.49 ± 0.80	68.80 ± 1.29	0.27
	BAH(cm)	60.78 ± 0.73^b	64.79 ± 0.82^a	64.21 ± 1.45 ^a	0.00**
	CC(cm)	35.70 ± 0.52^b	40.08 ± 0.87 ^a	33.03 ± 2.09 ^b	0.00**
	CBC(cm)	68.57 ± 0.96	71.56 ± 1.12	70.58 ± 1.85	0.14
	AC(cm)	10.79 ± 0.10	10.74 ± 0.11	10.73 ± 0.19	0.92
	BF(mm)	17.63 ± 0.43 ^b	18.33 ± 0.47 ^b	21.00 ± 0.77 ^a	0.01**
9th month	BW(kg)	24.63 ± 1.07	25.95 ± 1.58	25.65 ± 1.07	0.65
	BOH(cm)	41.21 ± 0.60	41.69 ± 0.86	41.43 ± 0.81	0.90
	BL(cm)	72.19 ± 0.92	73.54 ± 1.42	73.23 ± 1.88	0.70
	BAH(cm)	66.22 ± 0.99	67.31 ± 1.27	69.25 ± 1.38	0.33
	CC(cm)	39.69 ± 0.60	39.76 ± 0.87	40.34 ± 0.97	0.88
	CBC(cm)	74.39 ± 1.03	76.91 ± 1.49	77.56 ± 1.46	0.21
	AC(cm)	10.49 ± 0.10 ^b	11.01 ± 0.19 ^a	10.78 ± 0.21^a,b	0.03*
	BF(mm)	20.21 ± 0.37	20.75 ± 0.84	21.95 ± 1.19	0.23
12th month	BW(kg)	34.36 ± 1.23^a,b	30.94 ± 2.11 ^b	37.02 ± 1.09 ^a	0.04*
	BOH(cm)	46.39 ± 0.60^a,b	43.78 ± 1.11 ^b	47.71 ± 0.62^a	0.01*
	BL(cm)	83.32 ± 1.18	82.33 ± 1.75	84.22 ± 1.12	0.70
	BAH(cm)	78.36 ± 1.31^a,b	73.83 ± 2.42^b	81.32 ± 1.00^a	0.01**
	CC(cm)	45.58 ± 0.64	44.04 ± 1.29	47.05 ± 0.62	0.06
	CBC(cm)	113.03 ± 2.59	83.16 ± 2.97	89.95 ± 1.41	0.47
	AC(cm)	12.33 ± 0.15	11.88 ± 0.23	12.24 ± 0.16	0.45
	BF(mm)	22.82 ± 0.61	24.72 ± 1.26	24.57 ± 0.74	0.17

Notes: Values with different letters (a,b) within the same row represent significant differences among the three groups. (* P < 0.05, ** P < 0.01).