Variation in the AA-NAT gene G203A is associated with Awassi and Hamdani sheep fertility

Figures & data

Table 1. The Oligonucleotide primer sets are designed for the amplification of the ovine AA-NAT gene.

			Binding coordinates in the genome			Annealing
Primer code	Locus	Sequence (5′ - 3′)	Start	Stop	Amplicon length	temperature
AA-NAT,exo1-F	Exon 1	TCCAGGGTCTTCTCCCCAAG	54629822	54629841	300 bp	60.9 °C
AA-NAT,exo1-R		CTTGTCACACAGGCCCCTTC	54630121	54630102
AA-NAT,exo2-F	Exon 2	CCTTTCTTGAGGCCTTCCCG	54629407	54629426	313 bp	60.9 °C
AA-NAT,exo2-R		CCTGAATCCCATGGTTTCCCA	54629719	54629699
AA-NAT,exo3-F	Exon 3	CAGTGCATCTCCGTGAAGGT	54628859	54628878	287 bp	56.4 °C
AA-NAT,exo3-R		CTGACTCGTGTCCACCCCTC	54629145	54629126

The symbols ‘F’ and ‘R’ refer to forward and reverse primers, respectively. The design was based on the ovine NCBI Reference Sequence NC_056064.1.

Figure 1. An overview of the PCR-SSCP-sequencing technique applied to the analysis of the AA-NAT gene in Awassi and Hamdani ewes. (A) Primers were designed to amplify 300 bp, 313 bp, and 287 bp fragments in exon 1, exon 2, and exon 3, respectively. (B) PCR-SSCP genotyping revealed homozygous and heterozygous variations in exon 1. (C) Electropherograms of DNA sequencing were obtained for the GA genotype, which showed the SNP 203 G > a in exon 1. (D) Secondary structure prediction of different genotypes of mRNA in the AA-NAT gene.

Table 2. Genetic diversity of the AA-NAT gene in Awassi and Hamdani ewes detected by PCR-SSCP.

	Genotype frequencies (n)		Allele frequencies
Breed	GG	GA	G	A	Ho	He	Ne	χ2	PIC
Awassi	0.58 (76)	0.42 (54)	0.79	0.21	0.41	0.33	1.49	8.74	0.28
Hamdani	0.61 (43)	0.39 (27)	0.81	0.19	0.38	0.31	1.45	3.82	0.26

Abbreviations: n: number of individuals; Ho: observed heterozygosity; He: expected heterozygosity; Ne: effective allele frequency; PIC: polymorphism information content; χ²: Chi-square. All Chi-square tests have one degree of freedom and are within the significance level P ≤ 0.05.

Table 3. The association between AA-NAT genetic polymorphism and reproductive performance in Awassi and Hamdani ewes.

Breed	Genotypes	Birth type (%)		Lambing rate (%)	Survival rate %	Days to lambing (LSM ± SE)
		Singleton	Twin
A) Awassi	GG	41 (53.94%)	35 (46.05%)	98	110 (99.09%)	173^b ± 8.43
	GA	16 (29.62%)	38 (70.37%)	84	91 (98.91%)	161^a ± 7.69
	P-value	0.001	0.001	0.01	0.34	0.01
B) Hamdani	GG	31 (72.09%)	12 (27.90%)	97	54 (98.18%)	171^b ± 8.11
	GA	11 (40.74%)	16 (59.25%)	88	42 (97.67%)	160^a ± 9.01
	P-value	0.001	0.001	0.01	0.43	0.02

LSM ± SE, Least squares means ± Standard error, ^a,bSignificant differences in means are represented by differences in the same column within each classification, the P value with statistical significance is indicated in bold numbers.

Table 4. Logistic regression analysis of AA-NAT genotype and litter size in Awassi and Hamdani ewes.

Breed	Genotype	Litter size (LSM ± SE)	Logistic Regression analysis
			β	Odds ratio (95%CI)	P-value
A) Awassi	GG	1.46^b ± 0.13	1.00	Reference	0.001
	GA	1.70^a ± 0.10	1.01	2.74 (1.20–4.33)
B) Hamdani	GG	1.27^b ± 0.12	1.00	Reference	0.001
	GA	1.59^a ± 0.08	0.91	2.48 (1.11–4.64)

LSM ± SE, Least squares means ± Standard error, β: Regression coefficients, ^a,bSignificant differences in means represented by differences in the same column within each classification, the P value with statistical significance are indicated in bold numbers, CI: confidence interval.

Lambing rate (%) = (Number of ewes lambing/Number of ewes mated) X 100.

Litter size = Total number of lambs birth/Number of ewes lambing.

Fecundity rate (%) = (Number of live lambs born/Number of ewes mated) X 100.

Twinning rate (%) = (Number of ewes lambing twins/Number of ewes lambing) X 100.