Carbonate apatite nanoparticles carry siRNA(s) targeting growth factor receptor genes egfr1 and erbb2 to regress mouse breast tumor

Figures & data

Table 1. siRNAs used in this study.

Name	Target sequence	Targeted gene	Validation cell line	% Knock down
Allstars negative control siRNA	Proprietary	Proprietary	N/A	–
Allstars negative siRNA AF 488 (3′)	Proprietary	Proprietary	N/A	–
Hs_EGFR_10	TACGAATATTAAACACTTCAA	egfr1	HeLa	80
Hs_ERBB2_14	AACAAAGAAATCTTAGACGAA	erbb2	MCF7	92
Hs_IGF1R_1	ATGGAGAATAATCCAGTCCTA	igf1r	N/A	N/A

Table 2. Enhancement of cytotoxicity (%) due to complexation using 1 nM of siRNA(s) against GFR genes with NPs in MCF-7 cells. The enhancement values for NPs-siRNA(s) were compared to NPs (to confirm the effect of siRNA entrapment into complex structure).

siRNA against	% of cytotoxicity enhancement
egfr1	12.03 ± 1.8
erbb2	5.6 ± 0.5
igf1r	5.47 ± 2.8
egfr1; erbb2	25.67 ± 4.72
egfr1; igf1r	4.48 ± 3.5
erbb2; igf1r	0
egfr1; erbb2; igf1r	7.49 ± 4.9

%  in cytotoxicity enhancement =CV_NPs-CV_NPs-siRNA. Data were represented as mean ± SD for triplicate samples. ‘0’ denotes ‘no effect’.

Figure 1. (a) Size of NPs and binding interaction of negative siRNA with NPs formed with different conc. of CaCl₂. NPs were formed with 1–7 mM of exogenous CaCl₂ and 5 nM of AF488 negative control siRNA. (b) Cellular uptake of NPs-bound fluorescent negative siRNA. MCF-7 cells were treated with (i, ii) media (untreated), (iii, iv) NPs, (v, vi) free siRNA, and (vii, viii) NPs-siRNA formed with 3 mM of CaCl₂ and 10 nM AF488 negative control siRNA. Photos were captured at 40× magnification. Upper panel-light images, bottom panel-fluorescent images. Bar indicates 20 µm scale. (c) Fluorescence intensity of intracellular components. MCF-7 cells were treated with NPs, free siRNA, and NPs-siRNA formed with 3 mM of CaCl₂ and 10 nM AF488 negative control siRNA. After 6 h, fluorescence intensity of cell lysates was measured. Values are represented for duplicate samples: *p < .05 compared to NPs treatment.

Figure 2. Effect of NPs-loaded siRNA against single gene on viability of MCF-7 cells. Cells were treated with media (untreated), NPs, and NPs-siRNA (1 nM) formed with 3 mM CaCl₂. Values are represented as % of cell viability compared to untreated cells for triplicate samples. (a) NPs-negative siRNA and siRNA against; (b) egfr1; (c) erbb2; and (d) igf1r gene was used. *p < .05 compared to NPs treatment.

Figure 3. (a) Effect of NPs-loaded siRNA against single gene on caspase-mediated luminescence signal in MCF-7 cells. Cells were treated with media (untreated), NPs and NPs-siRNA (1 nM each siRNA against single GFR gene) formed with 3 mM of CaCl₂. Data were represented as mean ± SD for duplicate samples. (b) Effect of NPs-loaded siRNAs against combination of multiple GFR genes (egfr1, erbb2, and igf1r genes) on viability of MCF-7 cells. Cells were treated with media (untreated), NPs and NPs-siRNAs (1 nM each) formed with 3 mM CaCl₂. Values are represented as % of cell viability compared to untreated cells for triplicate samples. *p < .05 compared to NPs treatment.

Figure 4. (a) Effect of NPs-negative siRNA on tumor outgrowth in 4T1-cells induced mouse model. Mice were treated intravenously through tail-vein injection with 100 µL of either NPs or NPs-negative siRNA (50 nM) formed with 70 mM of CaCl₂. (b–d) Effect of NPs-siRNA(s) against single or multiple GFR genes on tumor outgrowth in 4T1-cells induced mouse model designed. Mice were treated intravenously through tail-vein injection with 100 µL of free/NPs-siRNA(s) formed in 70 mM of CaCl₂ and 50 nM of individual siRNA(s). Tumor outgrowth of mice treated with panel (b), NPs-siRNA against single GFR gene, (c) NPs-siRNAs against egfr1 and erbb2 genes, and (d) free/NP-siRNAs against all three GFR genes. Six mice/group were used and data were represented as mean ± SD. *p < .05 compared to NPs treatment.