Influence of seasons and sites on bioaerosols in indoor wastewater treatment plants and proposal for air quality indicators

Figures & data

Table 1. Description of treatment steps and number of sites sampled.

Steps	Treatment sites^a	Number of sites	Description of Activities
Pretreatment	Screening	8	Filtration of large and insoluble materials
	Grit/FOGs removal	7	Removal of granular matter and fats, oils and greases (FOGs)
Primary treatment	Settling tank	4	Residual particles and sludge settling
Secondary treatment	Biofiltration	4	Biological degradation of residual organic matter

^aSites are presented in chronological order determined by the treatment process.

Table 2. Primers and probes used to detect selected microorganisms by qPCR.

Microorganisms	Forward primers	Reverse primers	Probes	Reference
Total bacteria (bacteria 16S rDNA)	GGT AGT CYA YGC MST AAA CG	GAC ARC CAT GCA SCA CCT G	TKC GCG TTG CDT CGA ATT AAW CCA C	(Bach et al. 2002)
A. hydrophila	TYCGYTACCAGTGGGACAAG	CCRGCAAACTGGCTCTCG	CAGTTCCAGTCCCACCACTT	(Liu et al. 2012)
E. coli	GTT AAT ACC TTT GCT CAT TGA	ACC AGG GTA TCT AAT CCT GTT	–	(Malinen et al. 2003)
K. pneumoniae	CCTGGATCTGACCCTGCAGTA	CCGTCGCCGTTCTGTTTC	CAGGGTAAAAACGAAGGC	(Shannon et al. 2007)
P. aeruginosa	TGCTGGTGGCACAGGACAT	TTGTTGGTGCAGTTCCTCATTG	CAGATGCTTTGCCTCAA	(Shannon et al. 2007)

Figure 1. Relative humidity measured during different treatment steps at all WWTPs visited in winter and summer. The average relative humidity was lower in winter than in summer (p < 0.0001). There were also significant differences (*) in the relative humidity between treatment steps for both seasons (screening p = 0.002; degreasing/grit removal p = 0.0003; Biofiltration p = 0.005).

Figure 2. Correlation between relative humidity and total bacteria obtained by qPCR and culture, culturable gram-negative bacteria and endotoxins for all WWTPs.

Figure 3. Concentrations of culturable gram-negative bacteria measured in air during different treatment steps at all WWTPs visited in winter and summer. There was a significant difference (*) in culturable gram-negative bacteria concentrations between winter and summer at the screening site (p = 0.003) and the degreasing/grit removal site (p = 0.01). The solid line represents the IRSST recommended limit and the dotted line represents the recommended limit based on endotoxins/culturable gram-negative correlations in this study.

Figure 4. Concentrations of total culturable bacteria measured in air during different treatment steps at all WWTPs visited in winter and summer. Concentrations were significantly higher (*) in summer for the screening (p = 0.001) and the grit/FOG removal (p = 0.003). The solid line represents the IRSST recommended limit and the dotted line represents the recommended limit based on endotoxins/total culturable bacteria correlations in this study.

Figure 5. Concentrations of endotoxins measured in air during different treatment steps at all WWTPs visited in winter and summer. Concentrations were significantly higher (*) in summer compared to winter in screening (p = 0.01), degreasing/grit removal (p = 0.0003), and biofiltration (p = 0.03). The dotted line represents the Dutch Expert Committee on Occupational Safety (DECOS) recommended limit of exposure (LOE) for endotoxin concentration.

Figure 6. Correlation between endotoxins and total bacteria obtained by qPCR, Total culturable and culturable gram-negative bacteria for all WWTPs. The vertical dotted line represents the Dutch Expert Committee on Occupational Safety (DECOS) recommended exposure limits.

Figure 7. Concentrations of total bacteria obtained by qPCR during different treatment steps at WWTPs visited in winter and summer. Concentrations were significantly higher in summer (*) for the screening (p = 0.002), the degreasing/grit removal removal (p = 0.0003), and the settling tank (p = 0.006). The dotted line represents the recommended limit based on endotoxins/total bacteria by qPCR correlations in this study. The detection limit of the method is 100 copies 16S/m³).

Table 3. Concentrations of pathogenic bacteria found in the air at WWTPs in winter and summer at each of the treatment sites (gene copies/m³ air).

	E. coli		K. pneumoniae		A. hydrophila		P. aeruginosa
	Winter	Summer	Winter	Summer	Winter	Summer	Winter	Summer
Screening	3×10^1 – 2 × 10^3 (2×10^2)	9×10^1 – 1 × 10^5 (1×10^3)	< DL – 2 × 10^2 (< DL)	7×10° – 4 × 10^4 (8×10^2)	< DL – 3 × 10^2 (1×10^1)	2×10^1 – 2 × 10^4 (2×10^2)	< DL – 2 × 10^2 (< DL)	< DL – 1 × 10^4 (8×10^1)
Grit/FOG removal (median)	3×10^2 – 3 × 10^3 (1×10^3)	3×10^3 – 6 × 10^4 (6×10^3)	6×10° – 2 × 10^3 (1x10^2)	< DL – 3 × 10^4 (3x×10^3)	< DL – 6 × 10^2 (1×10^2)	2×10^2 – 3 × 10^4 (2×10^3)	< DL – 4 × 10^2 (2×10^1)	3×10^1 – 2 × 10^3 (6x10^2)
Settling tank (median)	2×10^2 – 4 × 10^3 (2×10^3)	6x×10^1 – 1 × 10^4 (3×10^3)	< DL – 2 × 10^3 (8×10^1)	< DL – 5 × 10^3 (8×10^1)	< DL – 4 × 10^2 (9×10^1)	1×10^1 ^– 4 × 10^3 (4×10^2)	< DL – 1 × 10^2 (1×10^1)	< DL – 1 × 10^3 (2×10^1)
Biofiltration (median)	5×10^2 – 2 × 10^4 (2×10^3)	6×10^2 – 1 × 10^4 (5×10^3)	2×10^1 – 7 × 10^3 (5×10^1)	3×10^1 – 1 × 10^4 (5×10^2)	< DL – 1 × 10^3 (7×10^2)	2×10^1 – 8 × 10^2 (5×10^2)	< DL – 3 × 10^3 (2×10°)	< DL – 4 × 10^3 (2×10^2)
Total (median)	3×10^1 -– 2 × 10^4 (1×10^3)	6×10^1 – 1 × 10^5 (4×10^3)	< DL – 7 × 10^3 (6×10^1)	< DL – 4 × 10^4 (8×10^2)	< DL – 1 × 10^3 (1×10^2)	1×10^1 – 3 × 10^4 (4×10^2)	< DL – 3 × 10^3 (6×10°)	< DL – 1 × 10^4 (1×10^2)

< DL: under the detection limit of the technique (5×10°/m³).

Figure 8. Correlation between the four pathogenic bacteria detected in the project and total bacteria obtained by qPCR for all WWTPs.

Bach, H.-J., J. Tomanova, M. Schloter, and J. C. Munch. 2002. Enumeration of total bacteria and bacteria with genes for proteolytic activity in pure cultures and in environmental samples by quantitative PCR mediated amplification. Journal of Microbiological Methods 49 (3):235–45. doi:10.1016/S0167-7012(01)00370-0.

 PubMed Web of Science ®Google Scholar

Liu, J., J. Gratz, A. Maro, H. Kumburu, G. Kibiki, M. Taniuchi, A.M. Howlader, S.U. Sobuz, R. Haque, K.A. Talukder, et al. 2012. Simultaneous detection of six diarrhea-causing bacterial pathogens with an in-house PCR-luminex assay. J. Clin. Microbiol. 50(1):98–103. doi:10.1128/JCM.05416-11.

 PubMedGoogle Scholar

Malinen, E., A. Kassinen, T. Rinttilä, and A. Palva. 2003. Comparison of real-time PCR with SYBR Green I or 5’-nuclease assays and dot-blot hybridization with rDNA-targeted oligonucleotide probes in quantification of selected faecal bacteria. Microbiology 149 (Pt 1):269–77. doi:10.1099/mic.0.25975-0.

 PubMedGoogle Scholar

Shannon, K. E., D. Y. Lee, J. T. Trevors, and L. A. Beaudette. 2007. Application of real-time quantitative PCR for the detection of selected bacterial pathogens during municipal wastewater treatment. Sci. Total Environ. 382 (1):121–29. doi:10.1016/j.scitotenv.2007.02.039.

 PubMed Web of Science ®Google Scholar