Genetic relationship in mulberry (Morus L.) inferred through PCR–RFLP and trnD-trnT sequence data of chloroplast DNA

Figures & data

Table 1. Materials used in this study.

No.	Genotype	Species	Ploidy	Source	Accession numbers
(1)	Menggusang	M. mongolica Schneid.	2n = 2x = 28	Shandong, China	KF886262
(2)	Shansang	M. bombycis Kiodz.	2n = 2x = 28	Shandong, China	KF886263
(3)	Beiqu No.1	M. atropurpurea Roxb.	2n = 2x = 28	Guangdong, China	KF886264
(4)	Nongsang No.12	M. multicaulis Perr.	2n = 2x = 28	Jiangsu, China	KF886265
(5)	Tongxiangqing	M. multicaulis Perr.	2n = 2x = 28	Zhejiang,China	KF886261
(6)	Husang No.32	M. multicaulis Perr.	2n = 2x = 28	Jiangsu, China	KF886266
(7)	Xinyizhilai	M. alba L.	2n = 2x = 28	Japan	KF886267
(8)	Fu No.1	M. alba L.	2n = 2x = 28	Jiangsu, China	KF886268

Table 2. Sequence and amplification conditions of cpDNA universal primer pairs used in this study.

No.	Amplified region	Forward primer (5′–3′)	Reverse primer (5′−3′)	Annealing temperature (°C)	Size (bp)	Reference
(1)	trnH-trnK	acgggaattgaacccgcgca	ccgactagttccgggttcga	55	1650	[19]
(2)	trnS-trnfM	gagagagagggattcgaacc	cataaccttgaggtcacggg	55	1650	[19]
(3)	rbcL	tgtcaccaaaaacagagact	ttccatacttcacaagcagc	55	1700	[10]
(4)	trnk1-trnk2	gggttgcccgggactcgaac	caacggtagagtactcggctttta	61.5	2500	[19]
(5)	trnC-trnD	ccagttcaaatctgggtgtc	gggattgtagttcaattggt	58	2950	[19]
(6)	trnD-trnT	accaattgaactacaatccc	ctaccactgagttaaaaggg	55	1200	[19]
(7)	trnM-rbcL	tgctttcatacggcgggact	gctttagtctctgtttgtgg	58	2850	[19]
(8)	trnF-trnVr	ctcgtgtcaccagttcaaat	ccgagaaggtctacggttcg	58	2200	[20]
(9)	trnS-trnT	cgagggttcgaatccctctc	agagcatcgcatttgtaatg	55	1500	[19]
(10)	psbC-trnS	ggtcgtgaccaagaaaccac	ggttcgaatccctctctctc	55	1600	[19]

Figure 1 Restriction patterns of amplified and digested products of primer–enzyme combination trnD-trnT/HinfI (A) and trnD-trnT /RsaI (B) of chloroplast DNA from eight Morus L. genotypes resolved in a 2% agarose gel. Numbers were listed in Table 1. M indicates DL2000 DNA Ladder Marker.

Figure 2 Phylogenetic tree of eight mulberry genotypes and related species M. indian based on the mutation sites in cpDNA trnD-trnT regions, using neighbour-joining method (MAGE).