Efficacious rat model displays non-toxic effect with Korean beechwood creosote: a possible antibiotic substitute

Figures & data

Table 1. Primer list for amplification of the hepatotoxicity marker.

Gene	Gene bank accession	Sense primer (5′–3′)	Antisense primer (5′–3′)
TIMP-1	NM_053819.1	GCACAGTGTTTCCCTGTTCA	GTCATCGAGACCCCAAGGTA
TIMP-2	NM_021989.2	AAGATCACACGCTGCCCTAT	GGGTCCTCGATGTCAAGAAA
TGF-в1	NM_021578.2	CAATGGGATCAGTCCCAAAC	TTCTCTGTGGAGCTGAAGCA
GAPDH	NM_017008.3	TGGAGTCTACTGGCGTCTT	TGTCATATTTCTCGTGGTTCA

Table 2. Effects of supplement on performance of rats (mean ± SD).

Index	Group I	Group II	Group III	Group IV	Group V
Initial weight (g)	229.77 ± 4.80	226.43 ± 13.53	242.03 ± 7.33	242.43 ± 28.65	234.37 ± 14.66
Final weight (g)	350.50 ± 10.40	333.65 ± 19.68	337.05 ± 11.20	342.53 ± 33.03	340.80 ± 17.92
Weight gain (g)	114.75 ± 14.58	108.89 ± 9.44	99.09 ± 9.50	108.31 ± 28.29	102.76 ± 19.05
Feed intake (g)	146.06 ± 26.00	134.31 ± 39.62	128.24 ± 29.51	139.07 ± 15.07	147.37 ± 34.15
Feed conversion	1.28 ± 0.15	1.24 ± 0.15	1.30 ± 0.10	1.30 ± 0.18	1.44 ± 0.09

Figure 1. Effect of Korean beechwood creosote on body weight gain at different time intervals.

Figure 2. Per cent increase in body weight in four weeks (after completion of supplementation).

Table 3. Fecal total Gram-negative bacterial count before and after one week of treatment (mean ± SD).

	Total coliforms count (log10 CFU/mL)
Time duration	Group I	Group II	Group III	Group IV	Group V
Before treatment	5.26 ± 1.76^a	6.91 ± 0.52^a	5.41 ± 1.24^a	5.69 ± 1.25^a	5.65 ± 1.21^a
After one week	5.27 ± 0.43^a	4.23 ± 0.6^b	5.04 ± 0.29^a	4.99 ± 0.39^a	5.29 ± 0.22^a

Note: Mean values with different superscripts within a column differ significantly (P < 0.05).

Table 4. Effect of Korean beech wood Creosote on blood hemogram (mean ± SD).

Blood hemogram	Group I	Group II	Group III	Group IV	Group V
WBC (10^3/μL)	12.59 ± 2.76	12.27 ± 2.66	12.14 ± 2.20	12.12 ± 2.03	12.75 ± 2.72
RBC (10^6/μL)	7.87 ± 0.45	7.89 ± 0.68	7.82 ± 0.60	7.78 ± 0.44	7.72 ± 0.58
Hb (g/dL)	15.70 ± 0.92	16.14 ± 1.28	15.22 ± 1.63	15.53 ± 1.00	15.46 ± 1.00
HCT (%)	47.35 ± 2.24	48.56 ± 2.04	47.65 ± 1.25	47.10 ± 0.91	47.11 ± 1.49
MCV (fL)	60.28 ± 3.55	61.88 ± 4.64	61.46 ± 4.42	60.68 ± 3.72	61.34 ± 4.93
MCH (pg)	19.96 ± 0.79	20.48 ± 0.46	19.41 ± 0.67	19.94 ± 0.42	20.03 ± 0.56
MCHC (g/dL)	33.15 ± 1.23	33.24 ± 2.22	31.90 ± 2.85	32.97 ± 2.15	32.85 ± 2.61
Platelets (10^3/μL)	121.15 ± 137.63	118.05 ± 117.95	120.30 ± 156.36	124.25 ± 171.31	121.37 ± 125.13

Table 5. Effect of Korean beech wood creosote on blood plasma biochemical constituents (mean ± SD).

Blood plasma constituents	Group I	Group II	Group III	Group IV	Group V
Glucose (mg/dL)	153 ± 28.34	151 ± 19.19	150 ± 26.16	147 ± 10.25	147 ± 9.28
Cholesterol (mg/dL)	81.83 ± 4.79	80.33 ± 9.50	68.33 ± 12.16	70 ± 7.59	77.67 ± 12.89
BUN (mg/dL)	15.50 ± 3.39	14.00 ± 2.68	15.17 ± 2.48	14.17 ± 0.98	14.83 ± 1.94
Total protein (g/dL)	5.53 ± 0.44	5.65 ± 0.24	5.40 ± 0.37	5.13 ± 0.37	5.52 ± 0.59
Albumin (g/dL)	4.07 ± 0.23	4.15 ± 0.29	3.75 ± 0.27	3.68 ± 0.29	3.80 ± 0.24
Globulin (g/dL)	1.47 ± 0.26	1.50 ± 0.11	1.65 ± 0.18	1.45 ± 0.23	1.72 ± 0.39
ALT (U/L)	67.67 ± 26.51	58.83 ± 12.78	59.33 ± 14.72	49.17 ± 6.11	51.17 ± 8.47
AST (U/L)	115.67 ± 42.97	88.67 ± 13.43	113.17 ± 39.93	80.83 ± 12.43	92.67 ± 34.06

Figure 3. RT-PCR detection of the expression of liver damage-related marker in rat liver tissues. GAPDH was used as an internal control.