Detection of Human parvovirus B19 (HPVB19) in serum samples from fever-rash ill individuals during the rubella outbreak (2005) in Bulgaria

Figures & data

Table 1. HPVB19-PCR – parameters (according to Servant et al. [4]).

Gene conservative	Primer ^a		Amplification profile
region	name	Nucleotide sequence (5′– 3′)	Cycle	Temperature (°C)	Time
NS1 NS1	e1905f e1987r	TGCAGATGCCCTCCACCCA GCTGCTTTCACTGAGTTCTTC	1 cycle	94 °C	6 min
				94 °C	30 sec
			5 cycles	55 °C	1 min
				72 °C	1 min
				94 °C	30 sec
			45 cycles	60 °C	30 sec
				72 °C	30 sec
			Final elongation	72 °C	7 min
			Hold	4 °C

Note: ^af: foreword; r: reverse primer.

Figure 1. Distribution of the positive results for HPVB19 and rubella IgM antibodies according to the defined age groups (%).

Figure 2. HPVB19-IgM and HPVB19-DNA positive results among the tested age groups (%).

Figure 3. Combined results from the two diagnostic methods for the detection of HPVB19 infection (%).

Figure 4. Electrophoresis in 2% and 3% agarose gels. (A) Lane 1: 50 bp molecular marker; Lane 2: negative control; Lanes 3, 4 and 5: samples with a positive result. (B) Lane 1: V9 DNA (no cleavage); Lane 2: HPVB19-DNA (two fragments with a size of 36 and 67 bp); Lane 3: 25 bp molecular marker.

Servant A, Laperche S, Lallemand F, Marinho V, De Saint Maur GG, Meritet JF, Garbarg-Chenon A. Genetic diversity within human erythroviruses: identification of three genotypes. J Virol. 2002;76:9124–9134.

 PubMed Web of Science ®Google Scholar