Assessment of genetic characteristics of Aconitum germplasms in Xinjiang Province (China) by RAPD and ISSR markers

Figures & data

Table 1. Aconitum specimens and their geographic origin.

No.	Species	Geographic location
1	Aconitum kusnezoffii Rdichb.	Sichuan Province, China
2	Aconitum carmichaelii Debx.	Sichuan Province, China
3	Aconitum soongaricum Stapf.	Tokkuztara County, Xinjiang Province, China
4	Aconitum leucostomum Worosch	Qinggil County, Xinjiang Province, China
5	Aconitum soongaricum Stapf.	Nilka County, Xinjiang Province, China
6	Aconitum soongaricum Stapf.	Nilka County, Xinjiang Province, China
7	Aconitum leucostomum Worosch	Burqin County, Xinjiang Province, China
8	Aconitum leucostomum Worosch.	Habahe County, Xinjiang Province, China
9	Aconitum leucostomum Worosch	Burqin County, Xinjiang Province, China
10	Aconitum leucostomum Worosch.	Fuyun County, Xinjiang Province, China
11	Aconitum leucostomum Worosch	Nilka County, Xinjiang Province, China
12	Aconitum carmichaelii Debx.	Sichuan Province, China
13	Aconitum carmichaelii Debx.	Sichuan Province, China
14	Aconitum kusnezoffii Rdichb.	Sichuan Province, China
15	Aconitum leucostomum Worosch	Nilka County, Xinjiang Province, China

Table 2. Primers sequences.

RAPD primers sequence			ISSR primers sequence
Primer	RAPD primer sequence (5′–3′)	Polymorphic rate (%)	Primer	ISSR primer sequence (5′--3′)	Polymorphic rate (%)
S14	TCCGCTCTGG	100	UBC814	(CT)8A	100
S28	GTGACGTAGG	100	UBC815	(CT)8G	100
S31	CAATCGCCGT	90.91	UBC818	(CA)8A	100
S36	AGCCAGCGAA	100	UBC822	(TC)8A	100
S38	AGGTGACCGT	100	UBC823	(TC)8C	100
S39	CAAACGTCGG	90.91	UBC824	(TC)8G	100
S40	GTTGCGATCC	88.89	UBC835	(AG)8YC	100
S41	ACCGCGAAGG	100	UBC844	(CT)8RC	100
S52	CACCGTATCC	100	UBC845	(CT)8RG	100
S54	CTTCCCCAAG	100	UBC846	(CA)8RT	100
S79	GTTGCCAGCC	100	UBC852	(TC)8RA	100
S81	CTACGGAGGA	90.00	UBC869	(GTT)6	88.89
S90	AGGGCCGTCT	100	UBC876	(GATA)2(GACA)2	100
S106	ACGCATCGCA	93.33	UBC879	(CTTCA)3	88.89
S112	ACGCGCATGT	100	UBC895	AGAGTTGGTAGCTCTTGATC	100

Table 3. Degree of polymorphism for RAPD and ISSR primers in 15 Aconitum specimens.

Marker	Number of primers	Total bands	Mean bands per primer	Range of bands (bp)	Total polymorphic bands	Polymorphic bands rate (%)
RAPD	15	182	12.13	100--2000	177	97.25
ISSR	15	185	12.33	100--2000	183	98.92

Figure 1. RAPD electrophoretic analysis of 15 Aconitum specimens (a: S112 primer; b: S41 primer). M: DL2000 DNA marker: 100 bp, 250 bp, 500 bp, 750 bp, 1000 bp, 2000 bp.

Figure 2. ISSR electrophoretic analysis of 15 Aconitum specimens (a: UBC881 primer; b: UBC823 primer). M: DL2000 DNA marker: 100 bp, 250 bp, 500 bp, 750 bp, 1000 bp, 2000 bp.

Figure 3. Dendrogram plot of 15 Aconitum specimens by UPGMA cluster analysis (RAPD).

Figure 4. Dendrogram plot of 15 Aconitum specimens by UPGMA cluster analysis (ISSR).

Table 4. Mean genetic data of three Aconitum specimens based on RAPD and ISSR markers.

Markers	population	Na	Ne	H	I	p	POL%
RAPD	P1	1.3956 ± 0.4903	1.2513 ± 0.3649	0.1447 ± 0.1958	0.2151 ± 0.2815	72	39.56
	P2	1.5385 ± 0.4999	1.3401 ± 0.3676	0.2007 ± 0.1982	0.2994 ± 0.2874	98	53.85
	P3	1.5989 ± 0.4915	1.3018 ± 0.3428	0.1845 ± 0.1838	0.2647 ± 0.2644	109	59.89
	Mean	1.9725 ± 0.1639	1.5130 ± 0.3243	0.3072 ± 0.1515	0.4686 ± 0.1911	93	51.10
ISSR	P1	1.5459 ± 0.4992	1.2996 ± 0.3433	0.1818 ± 0.1881	0.2770 ± 0.2731	101	54.59
	P2	1.2649 ± 0.4425	1.1502 ± 0.2781	0.0926 ± 0.1605	0.1406 ± 0.2395	49	26.49
	P3	1.5514 ± 0.4987	1.2979 ± 0.3531	0.1785 ± 0.1911	0.2718 ± 0.2745	102	55.14
	Mean	1.9892 ± 0.1037	1.4948 ± 0.3098	0.3021 ± 0.1422	0.4654 ± 0.1757	84	45.41

Note: N_a – observed number of alleles; N_e – effective number of alleles; H – Nei's gene diversity; I – Shannon's Information index; p – number of polymorphic loci; POL – percentage of polymorphic loci

Table 5. Genetic populations structure and estimate of gene flow within the populations of Aconitum.

Markers	Hs	Ht	Gst	Nm
ISSR	0.1766 ± 0.0123	0.3130 ± 0.0218	0.4358	0.6473
RAPD	0.1510 ± 0.0087	0.3022 ± 0.0203	0.5005	0.4991

Note: H_s – inter-populations diversity; H_t – total variability; G_st, Inter-populations differentiation, G_st = (1 − H_s/H_t); N_m, estimate of gene flow from G_st, N_m = 0.5 × (1 − G_st)/G_st.