Effect of internal primer–template mismatches on loop-mediated isothermal amplification

Figures & data

Table 1. LAMP primers targeting the 16S–23S rRNA intergenic spacer of S. dysgalactiae.

Primer	Sequence (5'–3')
FIP	AATGGAGCCTAGCGGGATCTTTTTTAGCTCAGCTGGGAGAG
BIP	TGTCCATTGAAAATTGAATATCTTTTTTCTTGTTACTATTCGTACAATCA
F3	GTTTTGAGAGGTCTTGTGG
B3	TTCACAGCGTTTTCGGTT
LF	TGCGTGCAAAGCAGGCG

Table 2. Specificity of the developed LAMP assay with primers targeting the 16S–23S rRNA intergenic spacer of S. dysgalactiae.

Bacterial strain (serotype)	Detection rate*
Streptococcus dysgalactiae ATCC 9542	3^a/3^b
Streptococcus uberis ATCC 700407	0/3
Streptococcus agalactiae ATCC 27956	3/3
Staphylococcus aureus ATCC 25923	0/3
Listeria monocytogenes J2-020 (1/2a)	0/3
Listeria monocytogenes J2-064 (1/2b)	0/3
Listeria monocytogenes J1-169 (3b)	0/3
Listeria monocytogenes J1-049 (3c)	0/3
Listeria monocytogenes M1-004 (N/A)	0/3
Listeria monocytogenes J1-094 (1/2c)	0/3
Listeria monocytogenes C1-115 (3a)	0/3
Listeria monocytogenes J1-031 (4a)	0/3
Listeria monocytogenes W1-110 (4c)	0/3
Listeria monocytogenes ATCC19115 (4b)	0/3
Listeria innocua ATCC51742	0/3
Escherichia coli O157:H7 933	0/3
Listeria ivanovii ATCC49954	0/3
Salmonella typhimurium	0/3
Escherichia coli O111:H8	0/3
Salmonella enterica serotype Newport	0/3
Escherichia coli O26:H11	0/3
Escherichia coli O121:H19	0/3
Escherichia coli O103:H2	0/3
Escherichia coli O145:H2	0/3
Escherichia coli O45:H12	0/3
Negative controls (TE)	0/3

Notes: *Self-prepared mixture, 100 pg DNA template.

^aNumber of LAMP positive.

^bNumber of total experiments carried out.

TE, Tris-EDTA buffer.

Figure 1. Specificity of the developed LAMP assay with primers targeting the 16S–23S rRNA intergenic spacer of S. dysgalactiae.

Figure 2. False priming sites between LAMP primers and DNA template of S. dysgalactiae.