Expression of defence-related genes in sunflower infected with broomrape

Figures & data

Table 1. Genes and primers used in study.

		Primer sequence
Gene	GeneBank ID	Forward	Reverse	Amplicon length, bp
NPR1	AY667500.1	agacgaatccaaaatcacgtt	gattaacatccgcacggttt	113
PR5	AF364864.1	tgcagccgtgttcactattc	catatacgggctcctgctgt	138
defensin	AF364865.1	atggccaaaatttcagttgc	ctcccaagacttgcactggt	168
PAL	Y12461.1	gcaaaagcttcgacaagtcc	taggcaaaatggccttcaac	125
Actin	AF282624.1	gctaacagggaaaagatgactc	actggcataaagagaaagcacg	96

Table 2. Phytopathological parameters estimation on investigated genotypes, artificially infected with three broomrape populations.

Genotype	Attack frequency (F, %)	Attack intensity (I)	Attacking rate (AR, %)	Resistance degree*
	Population from Soroca
MS-2161A	3,88	3,86	0,15	R
MS-2098A	96,97	4,47	4,33	SS
MS-2091A	100,00	15,53	15,53	SS
MS-2077A	94,44	10,53	9,94	SS
MS-2067A	94,29	5,48	5,17	SS
MS-2039A	10,29	7,17	0,74	T
MS-1589A	100,00	12,19	12,19	SS
	Population from Anenii Noi
MS-2161A	0,00	0,00	0,00	R
MS-2098A	78,79	3,22	2,54	SS
MS-2091A	94,44	9,12	8,61	SS
MS-2077A	88,89	3,66	3,25	SS
MS-2067A	52,78	2,37	1,25	SS
MS-2039A	7,06	3,00	0,21	T
MS-1589A	94,44	7,26	6,86	SS
	Population from Tulcea
MS-2161A	4,24	32,71	1,39	R
MS-2098A	88,24	4,50	3,97	SS
MS-2091A	100,00	12,85	12,85	SS
MS-2077A	91,67	11,64	10,67	SS
MS-2067A	91,43	6,16	5,63	SS
MS-2039A	15,29	21,19	3,24	T
MS-1589A	97,22	11,51	11,19	SS

*R – resistant; T – tolerant; SS – highly susceptible.

Figure 1. Fold change in NPR1 gene expression on infected (A) and non-symptomatic plants (B).

Figure 2. Fold change in PAL gene expression on infected (A) and non-symptomatic plants (B).

Figure 3. Fold change in defensin gene expression on infected (A) and non-symptomatic plants (B).

Figure 4. Fold change in PR5 gene expression on infected (A) and non-symptomatic plants (B).

Figure 5. Number of differential expression cases for sunflower ROS-scavenging genes under the influence of broomrape infection.