Searching for indigenous anaerobic ammonium oxidizing (anammox) bacteria in South African habitats: Pretoria region

Figures & data

Table 1. Composition of anammox mineral medium.

Compound	Concentration (g L^− ^1)
KNO3	0.2
KHCO3	1.25
NaH2PO4	0.05
CaCl2·2H2O	0.3
MgSO4·7H2O	0.2
FeSO4	0.006
EDTA	0.006
NaNO2	0.12
(NH4)SO4	0.15
Trace elements solution	1.25 mL L^−1

Table 2. Composition of trace elements solution.

Compound	Concentration (g L^−1)
H3BO3	0.5
CuSO4·5H2O	0.04
KI	0.1
FeCl3·6H2O	0.2
MnSO4·H2O	0.4
Na2MoO4·H2O	0.2
ZnSO4·7H2O	0.4
NaCl	1
CoSO4	0.1
CaCl2	0.1
AlK(SO4)2·12H2O	0.01

Table 3. PCR primers for anammox-bacteria-related 16s rRNA genes.

Primer	Target	Sequence (5'--3')
AMX 368F	All anammox bacteria except for Anammoxoglobus propionicus	TTCGCAATGCCCGAAAGG
AMX 820R	Brocadia anammoxidans, B rocadia fulgida and K uenenia stuttgartiensis	AAAACCCCTCTACTTAGTGCCC
BS 820R	Sculindua wagneri and S calindua sorokinii	TAATTCCCTCTACTTAGTGCCC

Figure 1. Middle reactor represents the results for the reactor inoculated with Daspoort sample collected from the middle part of an anaerobic digester.

Figure 2. Zeekoegaat anoxic represents results from reactor inoculated with sludge samples obtained from the anoxic zone of the secondary stage of Zeekoegaat treatment plant.

Figure 3. Control reactor represents the results for the reactor that was not inoculated with sludge.

Table 4. Summary of enrichment experiments.

WWTP	Zone of sampling	Enrichment
Daspoort	Trickling filter	Yes
Daspoort	Anaerobic digester (middle)	Yes
Daspoort	Anaerobic digester (bottom)	No
Baviaanspoort	Anoxic	No
Baviaanspoort	Anaerobic digester	No
Zeekoegaat	Anoxic	Yes
Zeekoegaat	Anaerobic digester	No

Figure 4. Phylogenetic tree showing relationships of anaerobic digester enrichment culture 16S rRNA gene clone to other anammox bacteria. The scale bar represents 2% sequence divergence.

Figure 5. Phylogenetic tree showing relationships of tickling filter and Zeekoegaat enrichment cultures 16S rRNA gene clone to other anammox bacteria. The scale bar represents 1% sequence divergence.

Table 5. Estimation of maximum growth rate using high F/M growth model.

Culture	X An (mg L^−1)	µ An (h^−1)	Decay (h^−1)	Yield (mg cell mg^−1 N)
Daspoort	8.2933585	0.101103	0.004899	9.8909667
Zeekoegaat	8.2395867	0.023865	0.00032	9.5331898

Figure 6. Comparison between measures and predicted values of NO₂ ⁻ – Daspoort sample.

Figure 7. Comparison between measures and predicted values of NO₂ ⁻ – Zeekoegaat sample.