Molecular and biochemical characterization of a novel cold-active and metal ion-tolerant GH10 xylanase from frozen soil

Figures & data

Table 1. Primers used in this study.

Primers	Primer sequence (5′–3′)
GH10F	CTACGACTGGGAYGTNIBSAAYGA
GH10R	GTGACTCTGGAWRCCIABNCCRT
SP1-U	ACAATACGCAGCGTGCCGTTGACCTTG
SP1-D	GACTGGGACGTTGGGAATGAGGCG
SP2-U	GTTGACCTTGCCACCGGGGCG
SP2-D	GCGAGGACTACATCAAGCTCGCCTTC
SP3-U	GCGCCTCATTCCCAACGTCCCAG
SP3-D	GACGGCATCCGCATCGACGGAC
PIC9F	GGGgaattcCAGATCAACAAGTGGGCCCAG
PIC9R	ACCgcggccgcGTGGTGGTGGTGGTGGTGTGCGTTGAACAGCTGCGCC

Notes: Italic letters represent the restriction enzyme sites.

Figure 1. Optimization of time (A,B) and temperature (C,D) for the expression of Xyn27. (A) SDS-PAGE analysis with different induction time: (M) protein marker (Thermo Fisher Scientific, Shanghai, China), (1) 12 h, (2) 24 h, (3) 36 h, (4) 48 h, (5) 60 h, (6) 72 h; (B) enzyme activity assays under different induction time. (C) SDS-PAGE analysis with different induction temperature: (M) protein marker, (1) 20 °C, (2) 25 °C, (3) 30 °C; (D) enzyme activity assays under different induction temperatures. Note: The highest activity at 60 h was used as 100% (B). The experiments were carried out three times, and each experiment included triplicates. Standard errors of the means (±SEM) were calculated from three independent experiments.

Figure 2. SDS-PAGE analysis of purified recombinant Xyn27. Lanes: M, protein marker (Thermo Fisher Scientific); (1) unpurified recombinant Xyn27; (2) purified recombinant Xyn27.

Figure 3. Ezymatic characterization of recombinant Xyn27. Effect of pH (A) on xylanase activity at 35 °C; effect of temperature (B) on xylanase activity at pH 7.0; pH stability (C) at 37 °C for 1 h in buffers of pH 3.0 to 10.0; thermostability (D) at 45 °C, 55 °C and 60 °C. Note: The enzyme activity at pH 7.0 (A), at 35 °C (B) or without any treatment (C,D) was taken as 100%. The experiments were carried out three times, and each experiment included triplicates. Standard errors of the means (±SEM) were calculated from three independent experiments.

Figure 4. Sequence alignment of Xyn27 with other mesophilic and thermophilic GH10 xylanases. Note: Identical residues are shaded in black; conserved residues are shaded in gray; putative catalytic residues are marked by a triangle. The dotted-line frames indicate the designed degenerate primers sequence. The boldface A, G, R, K are the putative amino-acid sites responsible for the cold-active property of Xyn27.

Table 2. Factors affecting the stability and flexibility of Xyn27 compared with other mesophilic or thermophilic counterparts.

Parameters	Xyn27	Xyn10B	XynA	XynC01	10b
Accession number	KY352354	3EMZ	AGG68962	AHE13927	1VBU
Identity (%)	100	26	62	62	32
Source	Saline soil	Paenibacillus barcinonensis	Humicola insolens	Achaetomium sp. Xz-8	Thermotoga maritima
Optimal temperature (°C)	35	50	80	75	105
pH	7	5.5	6	5.5
Arg (%)	3.17	6.34	4.75	3.97	4.57
Lys (%)	3.46	3.63	8.1	6.52	8.54
Gly (%)	7.78	5.44	8.1	9.07	5.18
Pro (%)	4.03	3.32	4.47	3.97	3.66
Ala (%)	11.82	7.55	9.78	9.63	6.1
Small aa	52.45	45.92	49.16	51	41.46
Hydrophbic aa	37.75	34.44	36.87	34.28	35.37
Reference	This study	[27]	[28]	[29]	[30]

aa, amino acid.

Figure 5. Effects of metal ions and chemicals on the activity of Xyn27. Note: The experiments were carried out three times, and each experiment included triplicates. Standard errors of the means (±SEM) were calculated from three independent experiments.

Table 3. Kinetic parameters of recombinant Xyn27 and other cold-active xylanases.

Xylanase	Xyn27	XynA	Xyn10	XynAHJ2	XynGR40	Xyn-FLA	XynA	XynA
Accession number	KY352354	ACN76857	AAY98787	AFE82288	ADN44261	FJ797706	HQ28064	9078911
Source	Saline soil	Glaciecola mesophila KMM241	Flavobacterium sp. MSY2	Bacillus sp. HJ2	Goat rumen contents	Alpine tundra soil	Sorangium cellulosum So9733-1	Zunongwangia profunda
pH	7.0	7.0	7.0	6.5	6.5	6.5	7	6.5
Optimal temperature (°C)	35	30	30	35	30	35	30-35	30
Km (mg mL^−1)	13.42	1.22	1.80	0.50	1.80	2.75	25.77	2.98
Vmax (μmol min^−1 mg^−1)	9.07	98.31	142.00	16.10	674.10	625.30	8.91	ND
kcat (s^−1)	3.22	69	100 .00	11.90	584.00	411.00	6.84	47.26
Reference	This study	[14]	[8]	[25]	[12]	[31]	[26]	[32]

ND, not determined.

Figure 6. HPLC analysis of the hydrolysis products of xylanase Xyn27 against beechwood xylan.

Gallardo Ó, Javier Pastor FI, Polaina J, et al. Structural insights into the specificity of Xyn10B from Paenibacillus barcinonensis and its improved stability by forced protein evolution. J Biol Chem. 2010;285(4):2721–2733.

 PubMed Web of Science ®Google Scholar

Du Y, Shi P, Huang H, et al. Characterization of three novel thermophilic xylanases from Humicola insolens Y1 with application potentials in the brewing industry. Bioresour Technol. 2013;130:161–167.

 PubMed Web of Science ®Google Scholar

Zhao L, Meng K, Shi P, et al. A novel thermophilic xylanase from Achaetomium sp. Xz–8 with high catalytic efficiency and application potentials in the brewing and other industries. Process Biochem. 2013;48(12):1879–1885.

 Web of Science ®Google Scholar

Ihsanawati, Kumasaka T, Kaneko T, et al. Structural basis of the substrate subsite and the highly thermal stability of xylanase 10B from Thermotoga maritima MSB8. Proteins. 2005;61(4):999–1009.

 PubMed Web of Science ®Google Scholar

Guo B, Chen XL, Sun CY, et al. Gene cloning, expression and characterization of a new cold-active and salt-tolerant endo-beta-1, 4-xylanase from marine Glaciecola mesophila KMM 241. Appl Microbiol Biotechnol. 2009;84(6):1107–1115.

 PubMed Web of Science ®Google Scholar

Lee CC, Smith M, Kibblewhite-Accinelli RE, et al. Isolation and characterization of a cold-active xylanase enzyme from Flavobacterium sp. Curr Microbiol. 2006;52(2):112–116.

 PubMed Web of Science ®Google Scholar

Zhou J, Dong Y, Tang X, et al. Molecular and biochemical characterization of a novel intracellular low-temperature-active xylanase. J Microbiol Biotechnol. 2012;22(4):501–509.

 PubMed Web of Science ®Google Scholar

Wang G, Luo H, Wang Y, et al. A novel cold-active xylanase gene from the environmental DNA of goat rumen contents: direct cloning, expression and enzyme characterization. Bioresour Technol. 2011;102(3):3330–3306.

 PubMed Web of Science ®Google Scholar

Wang GZ, Wang YR, Yang PL, et al. Molecular detection and diversity of xylanase genes in alpine tundra soil. Appl Microbiol Biotechnol. 2009;87:1383–1393.

 Web of Science ®Google Scholar

Wang SY, Hu W, Lin XY, et al. A novel cold-active xylanase from the cellulolytic myxobacterium Sorangium cellulosum So9733-1: gene cloning, expression, and enzymatic characterization. Appl Microbiol Biotechnol. 2011;93(4):1503–1512.

 PubMed Web of Science ®Google Scholar

Liu XS, Huang ZQ, Zhang XN, et al. Cloning, expression and characterization of a novel cold-active and halophilic xylanase from Zunongwangia profunda. Extremophiles. 2014;18:441–450.

 PubMed Web of Science ®Google Scholar