Assessment of genetic structure among different pear species (Pyrus spp.) using apple-derived SSR and evidence of duplications in the pear genome

Figures & data

Table 1. Different Pyrus accessions and their species used in this study.

Code	Cultivar name	Species	Code	Cultivar name	Species
1	Beurre Diel	P. communis	25	Beurre Hardy	P. communis
2	Spadona	P. communis	26	Chojuro	P. pyrifolia
3	Felestini*	P. communis	27	Nijisseiki	P. pyrifolia
4	Bartlett	P. communis	28	Olympic	P. pyrifolia
5	Seif Tabriz*	P. communis	29	Mohamad Ali*	P. communis
6	Harrow Sweet	P. communis	30	Khoj 1*	P. communis
7	Passe Crassane	P. communis	31	Duchesse	P. communis
8	Packham's Triumph	P. communis	32	Khoj 2 *	P. communis
9	Dare Gazi*	P. communis	33	Bulghar No. II	P. communis
10	Alvert	P. communis	34	Wild pear	P. salicifolia
11	Beurre d' Amanlis	P. communis	35	Beiroty*	P. communis
12	Unknown 3	P. communis	36	Boheme	P. communis
13	Unknown 1	P. communis	37	Bulghar No. III	P. communis
14	Shahak*	P. communis	38	Peighambari*	P. communis
15	William Duchesse	P. communis	39	Sebri*	P. communis
16	Domkaj Zard*	P. communis	40	Natanzi*	P. communis
17	Clapp's Favourite	P. communis	41	Domkaj Sabz*	P. communis
18	Tashkandi*	P. communis	42	Wild pear**	P. mazandaranica
19	Coscia	P. communis	43	Louise Bonne	P. communis
20	Kaiser	P. communis	44	Chinese pear***	P. bretschneideri
21	Shinko	P. pyrifolia	45	Passe Colmar	P. communis
22	Doyenné du Comice	P. communis	46	Konjoni*	P. communis
23	Unknown 2	P. communis	47	Kaftar Bache*	P. communis
24	Shahmive*	P. communis

*Native to Iran

**Endemic in Iran [19]

***Seedling

Table 2. SSR primer sequences that were used to study Pyrus genetic diversity.

Locus		Primer sequences (5′->3′)	Repeat type	MPA	FMPA (%)	PIC	Ave. Het.	I	Nei
CH02b10	F	CAAGGAAATCATCAAAGATTCAAG	Perfect	110	42.50	0.61	0.47	1.21	0.66
	R	CAAGTGGCTTCGGATAGTT
CH02h11a	F	CGTGGCATGCCTATCATTTG	Perfect	150	39.36	0.69	0.50	1.32	0.72
	R	CTGTTTGAACCGCTTCCTTC
CH05d04	F	ACTTGTGAGCCGTGAGAGGT	Perfect	120	67.02	0.69	0.29	1.08	0.66
	R	TCCGAAGGTATGCTTCGATT
CH01d08	F	CTCCGCCGCTATAACACTTC	Perfect	120	68.08	0.46	0.25	0.38	0.22
	R	TACTCTGGAGGGTATGTCAAAG
CH03g06	F	ATCCCACAGCTTCTGTTTTTG	Perfect	130	31.91	0.66	0.60	1.32	0.72
	R	TCACAGAGAATCACAAGGTGGA
CH04e03	F	TTGAAGATGTTTGGCTGTGC	Perfect	150	37.23	0.63	0.61	1.32	0.72
	R	TGCATGTCTGTCTCCTCCAT
MS14h03	F	CGCTCACCTCGTAGACGT	Perfect	120	50.00	0.44	0.53	0.97	0.59
	R	ATGCAATGGCTAAGCATA
NZ02b01	F	CCGTGATGACAAAGTGCATGA	Perfect	130	57.44	0.58	0.22	0.74	0.41
	R	ATGAGTTTGATGCCCTTGGA			49.19
Mean						0.59	0.43	1.04	0.59
SD					13.76	0.10	0.16	0.34	0.18

MPA, most prevalent allele; FMPA, frequency of most prevalent allele; PIC, polymorphic information content; SD, standard deviation; Nei, Nei's expected heterozygosity; Ave Het, average heterozygosity. I, Shannon information index

Table 3. Dice similarity coefficient among 47 Pyrus accessions obtained from SSR markers. Numbers in the first column and the first line represent different accessions according to Table 1.

		1	2	3	4	5	6	7	8	9	10	11	12	13	14	15	16	17	18	19	20	21	22	23	24
1	Beurre Diel	1.00
2	Spadona	0.55	1.00
3	Felestini*	0.57	0.53	1.00
4	Bartlett	0.67	0.52	0.73	1.00
5	Seif Tabriz*	0.42	0.64	0.73	0.58	1.00
6	Harrow Sweet	0.61	0.57	0.80	0.77	0.64	1.00
7	Passe Crassane	0.65	0.56	0.88	0.63	0.69	0.69	1.00
8	Packham's Triumph	0.59	0.55	0.71	0.63	0.62	0.62	0.67	1.00
9	Dare Gazi*	0.51	0.47	0.56	0.67	0.67	0.60	0.53	0.52	1.00
10	Alvert	0.74	0.60	0.81	0.79	0.60	0.80	0.71	0.58	0.50	1.00
11	Beurre d' Amanlis	0.61	0.79	0.60	0.58	0.64	0.71	0.63	0.69	0.53	0.60	1.00
12	Unknown 3	0.63	0.67	0.62	0.60	0.59	0.67	0.58	0.57	0.48	0.76	0.74	1.00
13	Unknown 1	0.59	0.56	0.59	0.63	0.56	0.69	0.56	0.73	0.47	0.65	0.63	0.58	1.00
14	Shahak*	0.41	0.34	0.39	0.31	0.48	0.48	0.36	0.40	0.32	0.45	0.41	0.50	0.55	1.00
15	William Duchesse	0.63	0.53	0.56	0.48	0.47	0.60	0.53	0.71	0.31	0.63	0.67	0.69	0.71	0.45	1.00
16	Domkaj Zard*	0.41	0.41	0.52	0.50	0.48	0.41	0.48	0.47	0.45	0.52	0.41	0.57	0.48	0.53	0.39	1.00
17	Clapp's Favourite	0.69	0.44	0.76	0.73	0.52	0.74	0.65	0.64	0.55	0.90	0.59	0.69	0.65	0.43	0.62	0.50	1.00
18	Tashkandi*	0.61	0.57	0.73	0.84	0.64	0.79	0.63	0.62	0.67	0.80	0.57	0.59	0.63	0.34	0.53	0.48	0.81	1.00
19	Coscia	0.61	0.57	0.73	0.58	0.50	0.64	0.69	0.69	0.47	0.73	0.64	0.67	0.63	0.34	0.67	0.41	0.81	0.64	1.00
20	Kaiser	0.53	0.55	0.58	0.50	0.55	0.48	0.61	0.67	0.39	0.52	0.55	0.64	0.61	0.47	0.65	0.60	0.50	0.48	0.62	1.00
21	Shinko	0.42	0.36	0.40	0.52	0.36	0.50	0.44	0.34	0.47	0.47	0.43	0.44	0.44	0.34	0.33	0.34	0.52	0.50	0.50	0.55	1.00
22	Doyenné du Comice	0.65	0.56	0.65	0.57	0.56	0.56	0.67	0.79	0.53	0.59	0.63	0.58	0.72	0.36	0.76	0.42	0.65	0.63	0.75	0.67	0.38	1.00
23	Unknown 2	0.53	0.62	0.65	0.63	0.69	0.55	0.55	0.73	0.58	0.65	0.55	0.64	0.67	0.40	0.58	0.53	0.64	0.69	0.62	0.60	0.34	0.73	1.00
24	Shahmive*	0.35	0.34	0.45	0.50	0.48	0.34	0.36	0.47	0.45	0.52	0.28	0.43	0.42	0.67	0.32	0.60	0.50	0.48	0.41	0.40	0.34	0.42	0.60	1.00
25	Beurre Hardy	0.48	0.50	0.47	0.45	0.43	0.50	0.50	0.62	0.40	0.47	0.50	0.59	0.69	0.48	0.60	0.48	0.52	0.43	0.64	0.90	0.57	0.63	0.55	0.34
26	Chojuro	0.47	0.48	0.39	0.56	0.41	0.41	0.42	0.40	0.39	0.52	0.48	0.64	0.48	0.40	0.45	0.40	0.50	0.41	0.48	0.60	0.76	0.42	0.47	0.40
27	Nijisseiki	0.51	0.47	0.44	0.61	0.40	0.47	0.47	0.39	0.44	0.56	0.47	0.62	0.47	0.39	0.44	0.39	0.55	0.47	0.53	0.58	0.80	0.47	0.45	0.39
28	Olympic	0.42	0.50	0.47	0.39	0.43	0.36	0.50	0.41	0.40	0.53	0.43	0.59	0.38	0.34	0.40	0.34	0.52	0.36	0.64	0.62	0.71	0.44	0.48	0.48
29	Mohamad Ali*	0.61	0.58	0.42	0.59	0.45	0.52	0.40	0.50	0.55	0.61	0.52	0.53	0.57	0.38	0.55	0.38	0.60	0.65	0.52	0.56	0.52	0.63	0.63	0.44
30	Khoj 1*	0.30	0.29	0.40	0.45	0.43	0.29	0.31	0.41	0.33	0.47	0.21	0.37	0.38	0.62	0.27	0.55	0.44	0.43	0.36	0.34	0.21	0.38	0.55	0.90
31	Duchesse	0.50	0.59	0.69	0.73	0.74	0.67	0.58	0.64	0.62	0.62	0.59	0.54	0.58	0.29	0.41	0.36	0.54	0.67	0.52	0.43	0.37	0.58	0.71	0.50
32	Khoj 2 *	0.56	0.52	0.42	0.47	0.52	0.39	0.51	0.56	0.61	0.48	0.39	0.40	0.57	0.38	0.48	0.38	0.47	0.52	0.45	0.56	0.39	0.69	0.63	0.44
33	Bulghar No. II	0.61	0.52	0.48	0.59	0.45	0.45	0.57	0.63	0.48	0.48	0.52	0.53	0.46	0.31	0.55	0.44	0.47	0.52	0.52	0.75	0.45	0.69	0.56	0.44
34	Wild pear	0.45	0.54	0.64	0.55	0.54	0.54	0.67	0.74	0.43	0.57	0.54	0.56	0.60	0.37	0.64	0.52	0.64	0.62	0.69	0.67	0.46	0.73	0.67	0.52
35	Beiroty*	0.47	0.69	0.58	0.44	0.55	0.48	0.55	0.60	0.52	0.58	0.62	0.57	0.61	0.33	0.58	0.40	0.64	0.55	0.83	0.60	0.48	0.67	0.67	0.47
36	Boheme	0.55	0.57	0.67	0.65	0.50	0.64	0.63	0.62	0.47	0.67	0.64	0.67	0.50	0.28	0.60	0.34	0.67	0.57	0.71	0.55	0.43	0.63	0.62	0.41
37	Bulghar No. III	0.51	0.60	0.56	0.48	0.53	0.47	0.59	0.71	0.44	0.50	0.60	0.55	0.71	0.45	0.69	0.52	0.55	0.53	0.67	0.65	0.33	0.88	0.65	0.52
38	Peighambari*	0.59	0.63	0.53	0.51	0.56	0.56	0.50	0.73	0.47	0.59	0.69	0.65	0.78	0.42	0.82	0.42	0.65	0.63	0.69	0.61	0.38	0.83	0.73	0.36
39	Sebri*	0.39	0.52	0.55	0.41	0.58	0.52	0.51	0.50	0.61	0.48	0.52	0.47	0.51	0.44	0.36	0.44	0.53	0.45	0.52	0.44	0.39	0.46	0.56	0.44
40	Natanzi*	0.35	0.34	0.58	0.44	0.62	0.55	0.48	0.53	0.52	0.52	0.41	0.43	0.55	0.53	0.45	0.33	0.57	0.48	0.55	0.33	0.28	0.48	0.53	0.53
41	Domkaj Sabz*	0.34	0.40	0.50	0.48	0.47	0.40	0.47	0.52	0.50	0.50	0.33	0.48	0.47	0.45	0.38	0.84	0.55	0.60	0.47	0.52	0.33	0.47	0.65	0.65
42	Wild pear**	0.71	0.55	0.45	0.56	0.41	0.55	0.48	0.67	0.39	0.58	0.62	0.64	0.73	0.60	0.65	0.47	0.57	0.55	0.55	0.53	0.41	0.61	0.60	0.53
43	Louise Bonne	0.69	0.52	0.62	0.60	0.52	0.59	0.65	0.57	0.41	0.76	0.59	0.77	0.58	0.43	0.55	0.43	0.77	0.59	0.74	0.57	0.52	0.58	0.64	0.43
44	Chinese pear***	0.52	0.31	0.50	0.55	0.46	0.62	0.47	0.44	0.57	0.57	0.54	0.48	0.47	0.44	0.43	0.30	0.64	0.54	0.46	0.30	0.38	0.40	0.37	0.37
45	Passe Colmar	0.63	0.59	0.69	0.53	0.52	0.59	0.71	0.64	0.48	0.69	0.67	0.69	0.58	0.36	0.62	0.43	0.77	0.59	0.96	0.64	0.52	0.71	0.57	0.36
46	Konjoni*	0.53	0.56	0.59	0.64	0.64	0.80	0.55	0.62	0.67	0.59	0.72	0.67	0.62	0.46	0.52	0.38	0.67	0.72	0.56	0.46	0.48	0.48	0.62	0.31
47	Kaftar Bache*	0.56	0.59	0.69	0.60	0.67	0.52	0.65	0.64	0.55	0.69	0.52	0.69	0.58	0.43	0.48	0.57	0.69	0.67	0.67	0.57	0.37	0.58	0.79	0.57
		25	26	27	28	29	30	31	32	33	34	35	36	37	38	39	40	41	42	43	44	45	46	47
1	Beurre Diel
2	Spadona
3	Felestini*
4	Bartlett
5	Seif Tabriz*
6	Harrow Sweet
7	Passe Crassane
8	Packham's Triumph
9	Dare Gazi*
10	Alvert
11	Beurre d' Amanlis
12	Unknown 3
13	Unknown 1
14	Shahak*
15	William Duchesse
16	Domkaj Zard*
17	Clapp's Favourite
18	Tashkandi*
19	Coscia
20	Kaiser
21	Shinko
22	Doyenné du Comice
23	Unknown 2
24	Shahmive*
25	Beurre Hardy	1.00
26	Chojuro	0.62	1.00
27	Nijisseiki	0.60	0.97	1.00
28	Olympic	0.64	0.76	0.73	1.00
29	Mohamad Ali*	0.58	0.56	0.61	0.52	1.00
30	Khoj 1*	0.29	0.34	0.33	0.36	0.39	1.00
31	Duchesse	0.37	0.43	0.41	0.44	0.53	0.44	1.00
32	Khoj 2 *	0.58	0.44	0.48	0.45	0.71	0.45	0.47	1.00
33	Bulghar No. II	0.71	0.50	0.48	0.58	0.65	0.39	0.53	0.65	1.00
34	Wild pear	0.62	0.52	0.50	0.54	0.48	0.46	0.56	0.62	0.62	1.00
35	Beiroty*	0.62	0.47	0.45	0.69	0.56	0.34	0.50	0.50	0.50	0.67	1.00
36	Boheme	0.57	0.55	0.53	0.64	0.58	0.36	0.67	0.45	0.71	0.69	0.62	1.00
37	Bulghar No. III	0.60	0.45	0.44	0.47	0.55	0.47	0.55	0.61	0.67	0.79	0.71	0.60	1.00
38	Peighambari*	0.63	0.48	0.47	0.44	0.74	0.31	0.52	0.63	0.57	0.67	0.73	0.63	0.76	1.00
39	Sebri*	0.52	0.38	0.36	0.52	0.47	0.32	0.47	0.47	0.41	0.48	0.69	0.52	0.48	0.57	1.00
40	Natanzi*	0.41	0.33	0.32	0.41	0.38	0.48	0.50	0.44	0.38	0.52	0.53	0.62	0.52	0.55	0.63	1.00
41	Domkaj Sabz*	0.47	0.39	0.38	0.40	0.55	0.60	0.41	0.48	0.48	0.64	0.52	0.47	0.56	0.53	0.48	0.45	1.00
42	Wild pear**	0.55	0.47	0.45	0.41	0.56	0.48	0.50	0.50	0.56	0.52	0.47	0.55	0.58	0.67	0.44	0.40	0.45	1.00
43	Louise Bonne	0.59	0.57	0.55	0.67	0.47	0.37	0.54	0.40	0.60	0.56	0.64	0.67	0.55	0.58	0.53	0.50	0.41	0.64	1.00
44	Chinese pear***	0.38	0.37	0.36	0.38	0.41	0.31	0.48	0.41	0.48	0.42	0.37	0.62	0.36	0.47	0.48	0.67	0.29	0.44	0.56	1.00
45	Passe Colmar	0.67	0.50	0.55	0.67	0.47	0.30	0.46	0.47	0.53	0.64	0.79	0.67	0.62	0.65	0.53	0.50	0.41	0.57	0.77	0.48	1.00
46	Konjoni*	0.56	0.46	0.44	0.40	0.50	0.24	0.58	0.43	0.50	0.52	0.54	0.64	0.44	0.62	0.64	0.62	0.44	0.62	0.67	0.70	0.58	1.00

Table 4. Number of alleles and private alleles observed in different species of Pyrus in this experiment.

	Number of alleles
SSR name	P. communis	P. pyrifolia	P. salicifolia	P. mazandaranica	P. bretschneideri
CH02b10	5	4	2	1	2
CH02h11a	8	4	2	1	2
NZ02b01	6	5	1	1	1
CH05d04	7	4	1	1	1
CH01d08	6	2	2	1	1
CH03g06	5	4	2	2	2
CH04e03	8	4	2	2	2
MS14h03	4	2	2	2	2
Total number of alleles	49	29	14	11	13
Number of private alleles	14	2	0	0	1
Loci with private allele	CH02h11a(3), NZ02b01(3), CH05d04(3), CH01d08(2), CH04e03(3)	CH02b10(1), CH04e03(1)			MS14h03

Figure 1. Genetic structure of 47 pear accessions obtained from STRUCTURE analysis. (A) Results of Structure Harvester representing K = 3 as the best numbers of groups according to the delta K method. (B) Pattern of accession assignments into three different groups using the STRUCTURE model. Different colour of each vertical line represents the percent of membership (vertical values on the left of cluster) of each individual for three groups. Numbers at the bottom represent the samples based on Table 1.

Figure 2. Principal coordinates of 47 accessions based on eight SSR loci.

Figure 3. Dendrogram of five Pyrus species according to Nei's genetic identity depicted by Mega 6 software.

Figure 4. Banding patterns generated by using CH04e03 SSR marker showing duplication in some accessions.

Rechinger KH. Flora Iranica, no 66. Graz, Austria: Akademische Druck-und Verlagsanstalt; 1969.

 Google Scholar