Diversity and antimicrobial activity of culturable actinobacteria isolated from the sediment of Sarıkum Lake

Figures & data

Table 1. Locality and geographic coordinates of sediment samples.

Locality	Geographic coordinates
Mid-lake coastal area	42° 01′ 00″ N 34° 55′ 38″ E
Sea front of the lake	42° 01′ 25″ N 34° 54′ 31″ E
Lake coastline	42° 01′ 34″ N 34° 54′ 34′’ E

Table 2. List of selective media used and codes of isolates.

Number	Isolate codes	Name of medium	Antibiotic	References
1	SL05, SL19, SL20, SL21, SL51, SL52, SL53, SL78, SL80, SL84, SL92, SL93	Humic Acid-Vitamin Agar	Cycloheximide (50 µg/mL), Nalidixic acid (10 µg/mL)	[35]
2	SL30, SL31, SL32, SL34, SL41, SL42, SL44, SL54, SL62, SL65, SL66, SL86, SL87, SL88, SL97, SL109	Starch-Casein Agar	Cycloheximide (50 µg/mL), Nystatin (50 µg/mL)	[36]
3	SL13, SL27, SL49, SL98, SL100, SL101, SL102, SL103	Nocardia Agar	Cycloheximide (50 µg/mL), Nystatin (50 µg/mL)	[37]
4	–	SM1 Agar	Nystatin (50 µg/mL), Nalidixic acid (10 µg/mL), Neomycin sulfate (10 µg/mL)	[38]
5	–	SM2 Agar	Nystatin (50 µg/mL), Nalidixic acid (10 µg/mL), Neomycin sulfate (10 µg/mL)	[38]
6	–	SM3 Agar	Nystatin (50 µg/mL), Rifampicin (5 µg/mL)	[38]
7	SL35, SL48, SL59, SL77, SL105, SL108	Marine agar	Cycloheximide (50 µg/mL), Nystatin (50 µg/mL)
8	–	R2A Agar	Cycloheximide (50 µg/mL), Nystatin (50 µg/mL)	[39]
9	SL67, SL68	M1 Agar	Cycloheximide (50 µg/mL), Nystatin (50 µg/mL), Rifampicin (5 µg/mL)	[40]
10	SL37, SL38, SL39, SL64	Oligotrophic Agar	Cycloheximide (50 µg/mL), Nystatin (50 µg/mL), Rifampicin (5 µg/mL)	[41]

Table 3. Oligonucleotide primers used for 16S rRNA PCR amplification and sequencing.

Primer code	Sequences (5′–3′)	Base length	References
27F	AGAGTTTGATC(AC)TGGCTCAG	21	[16]
518F	CCAGCAGCCGCGGTAAT	17	[42]
800R	TACCAGGGTATCTAATCC	18	[17]
MG5F	AAACTCAAAGGAATTGACGG	20	[17]
MG6F	GACGTCAAGTCATCATGCC	19	[17]
1492R	ACGG(CT)TACCTTGTTACGACTT	21	[16]

Table 4. Primers used for amplification of NRPS, PKS-I and II gene regions.

Target genes	Primers	Base length	Product length (bp)	References
NRPS	A3F (5′GCSTACSYSATSTACACSTCSGG3′)	23	700–800	[9]
	A7R (5′SASGTCVCCSGTSCGGTAS3′)	19
PKS-I	K1F (5′TSAAGTCSAACATCGGBCA3′)	19	1200–1400	[9]
	M6R (5′CGCAGGTTSCSGTACCAGTA3′)	20
PKS-II	KSαF (5′TSGCSTGCTTGGAYGCSATC3′)	20	613	[43]
	KSαR (5′TGGAANCCGCCGAABCCGCT3′)	20

Table 5. Summary of information on 16S rRNA sequence determination of isolated strains.

Number	Strain	Accession number	Highest match	Similarity (%)-Nucleotide difference
1.	SL48	MN812720	Streptomyces qinglanensis 172205^T	99.93% − 1/1448
2.	SL52	MN818636	Streptomyces qinglanensis 172205^T	99.93% − 1/1449
3.	SL59	MN818646	Streptomyces qinglanensis 172205^T	100% − 0/1449
4.	SL77	MN822706	Streptomyces qinglanensis 172205^T	99.93% − 1/1448
5.	SL92	MN822725	Streptomyces qinglanensis 172205^T	99.65% − 5/1448
6.	SL13	MN811627	Streptomyces wuyuanensis CGMCC 4.7042^T	100% − 0/1440
7.	SL20	MN812279	Streptomyces wuyuanensis CGMCC 4.7042^T	100% − 0/1440
8.	SL31	MN812664	Streptomyces neopeptinius KNF 2047^T	99.28% − 10/1398
9.	SL34	MN812677	Streptomyces neopeptinius KNF 2047^T	99.28% − 10/1398
10.	SL102	MN823075	Streptomyces caeruleatus NRRL B-24802^T	99.52% − 7/1447
11.	SL109	MN932120	Streptomyces caeruleatus NRRL B-24802^T	99.52% − 7/1448
12.	SL19	MN811648	Streptomyces glauciniger CGMCC 4.1858^T	99.72% − 4/1441
13.	SL30	MN812662	Streptomyces yangpuensis fd2-tb^T	100% − 0/1446
14.	SL35	MN812678	Streptomyces chumphonensis K1-2^T	99.86% − 2/1453
15.	SL37	MN812679	Streptomyces scabiei NRRL B-16523^T	99.79% − 3/1448
16.	SL39	MN812682	Streptomyces aculeolatus NBRC 14824^T	99.86% − 2/1440
17.	SL49	MN818640	Streptomyces xinghaiensis S187^T	99.93% − 1/1448
18.	SL78	MN809579	Streptomyces karpasiensis K413^T	98.62% − 20/1448
19.	SL84	MN809580	Streptomyces haliclonae DSM 41968^T	98.41% − 23/1448
20.	SL32	MN812668	Micromonospora tulbaghiae DSM 45142^T	100% − 0/1437
21.	SL53	MN818642	Micromonospora tulbaghiae DSM 45142^T	100% − 0/1437
22.	SL54	MN818645	Micromonospora tulbaghiae DSM 45142^T	99.93% − 1/1437
23.	SL64	MN818651	Micromonospora tulbaghiae DSM 45142^T	100% − 0/1437
24.	SL65	MN818654	Micromonospora tulbaghiae DSM 45142^T	100% − 0/1437
25.	SL105	MN823085	Micromonospora tulbaghiae DSM 45142^T	100% − 0/1437
26.	SL05	MN812168	Micromonospora taraxaci DSM 45885^T	99.65% − 5/1437
27.	SL68	MN822705	Micromonospora taraxaci DSM 45885^T	99.58% − 6/1436
28.	SL66	MN818670	Micromonospora chalcea DSM 43026^T	99.51% − 7/1437
29.	SL101	MN823072	Micromonospora chalcea DSM 43026^T	99.58% − 6/1437
30.	SL41	MN812684	Micromonospora kangleipakensis MBRL 34^T	99.79% − 3/1413
31.	SL42	MN812695	Micromonospora halotolerans CR18^T	99.44% − 8/1429
32.	SL44	MN812709	Micromonospora chaiyaphumensis DSM 45246^T	99.10% − 13/1437
33.	SL86	MN932112	Micromonospora vinacea GUI63^T	99.72% −4/1418
34.	SL97	MN822727	Micromonospora schwarzwaldensis HKI0641^T	99.93% − 1/1437
35.	SL98	MN932114	Micromonospora gifhornensis DSM 44337^T	99.65% − 5/1437
36.	SL100	MN823065	Micromonospora fiedleri MG-37^T	99.78% − 3/1381
37.	SL21	MN812656	Rhodococcus coprophilus NBRC 100603^T	99.72% − 4/1445
38.	SL38	MN812680	Rhodococcus coprophilus NBRC 100603^T	100% − 0/1445
39.	SL80	MN822707	Rhodococcus coprophilus NBRC 100603^T	100% − 0/1445
40.	SL93	MN822726	Rhodococcus coprophilus NBRC 100603^T	100% − 0/1445
41.	SL51	MN932113	Rhodococcus hoagii DSM 20295^T	99.58% − 6/1439
42.	SL62	MN818650	Plantactinospora sonchi NEAU-QY2^T	99.51% − 7/1438
43.	SL67	MN818671	Plantactinospora siamensis CM2-8^T	99.10% − 13/1438
44.	SL103	MN823080	Plantactinospora endophytica YIM 68255^T	99.58% − 6/1438
45.	SL27	MN812661	Nonomuraea coxensis DSM 45129^T	100% − 0/1425
46.	SL88	MN822710	Nonomuraea maritima FXJ7.203^T	99.65% − 5/1441
47.	SL108	MN829436	Actinomadura sporangiiformans NEAU-Jh2-5^T	99.79% − 3/1440
48.	SL87	MN822708	Streptosporangium jiaoheense NEAU-Jh1-4^T	99.79% − 3/1444

Figure 1. Neighbor-joining tree [20] based on 16S rRNA gene sequences showing the position of isolated Streptomyces strains among their phylogenetic neighbors. Numbers at the nodes demonstrate the levels of bootstrap support (%); only values ≥ 50% are shown. GenBank accession numbers are placed in parentheses. Bar, 0.005 substitutions per nucleotide position.

Figure 2. Neighbor-joining tree [20] based on 16S rRNA gene sequences showing the position of isolated Micromonospora strains among their phylogenetic neighbors. Numbers at the nodes demonstrate the levels of bootstrap support (%); only values ≥ 50% are shown. GenBank accession numbers are placed in parentheses. Bar, 0.1 substitutions per nucleotide position.

Figure 3. Neighbor-joining tree [20] based on 16S rRNA gene sequences showing relationships between the isolates and recognized species of the genera Rhodococcus, Plantactinospora, Nonomuraea, Streptosporangium and Actinomadura strains among their phylogenetic neighbors. The numbers at the nodes demonstrate the levels of bootstrap support (%); only values ≥ 50% are given. GenBank accession numbers are placed in parentheses. Bar, 0.01 substitutions per nucleotide position.

Table 6. Inhibition zone diameters caused by test organisms against different microorganisms (mm).

No	Test isolates	1	2	3	4	5	6	7	8
1	SL05	30	–	–	–	–	–	–	–
2	SL13	–	–	–	–	–	–	–	–
3	SL19	–	–	–	–	–	–	–	–
4	SL20	–	–	–	–	–	–	–	–
5	SL21	–	–	–	–	–	–	–	–
6	SL27	–	–	–	–	–	–	–	–
7	SL30	–	–	–	–	30	–	–	–
8	SL31	–	30	–	–		–	–	–
9	SL32	–	30	–	–	20	–	–	–
10	SL34	–	32	–	–	–	–	–	–
11	SL35	–	–	60	–	–	–	–	–
12	SL37	–	–	–	–	–	–	–	–
13	SL38	–	–	–	–	–	–	–	–
14	SL39	–	–	44	–	–	–	–	–
15	SL41	–	–		–	–	–	–	–
16	SL42	–	11	15	–	–	10	–	–
17	SL44	–	–	–	–	–	–	–	–
18	SL48	–	–	–	–	–	–	–	–
19	SL49	–	–	20	–	–	–	–	–
20	SL51	–	–	–	–	–	–	–	–
21	SL52	–	–	–	–	–	–	–	–
22	SL53	–	–	–	–	–	–	–	–
23	SL54	–	–	–	–	–	–	–	–
24	SL59	–	–	–	–	–	–	–	–
25	SL62	–	–	–	–	–	–	–	–
26	SL64	–	–	–	–	–	–	–	–
27	SL65	–	–	–	–	–	–	–	–
28	SL66	–	–	–	–	–	–	–	–
29	SL67	–	–	–	–	–	–	–	–
30	SL68	–	–	–	–	–	–	–	–
31	SL77	–	–	25	–	–	–	–	–
32	SL78	17	30	–	–		36	–	–
33	SL80	–	–	–	–	–	–	–	–
34	SL84	–	42	–	–	–	40	–	–
35	SL86	–	–	–	–	–	–	–	–
36	SL87	–	–	–	–	–	–	–	–
37	SL88	–	–	–	–	–	–	–	–
38	SL92	–	–	–	–	–	–	–	–
39	SL93	–	–	–	–	–	–	–	–
40	SL97	–	–	–	–	–	–	–	–
41	SL98	–	–	–	–	–	–	–	–
42	SL100	–	–	–	–	–	–	–	–
43	SL101	–	–	–	–	–	–	–	–
44	SL102	–	–	–	–	–	–	–	–
45	SL103	–	–	–	–	–	–	–	–
46	SL105	–	–	–	–	–	–	–	–
47	SL108	–	–	–	–	–	–	–	–
48	SL109	–	–	–	–	–	–	–	–

Strains: 1, Bacillus subtilis ATCC 6633^T; 2, Enterococcus faecalis ATCC 29212^T; 3, Staphylococcus aureus ATCC 25923^T; 4, Escherichia coli ATCC 25922^T; 5, Klebsiella pneumoniae ATCC 700603^T; 6, Pseudomonas aeruginosa ATCC 27853^T; 7, Aspergillus niger ATCC 16404^T; 8, Candida albicans ATCC 10231^T.

–, no activity.

Figure 4. Images of PKS-I and PKS-II gene regions PCR amplification products of positive isolates in 1.5% agarose gel. EtBr was added to the gel before electrophoresis to a final concentration of 0.5 μg/mL, followed by separation at 100 V for 1 h. Marker (Biolabs 1 kb DNA Ladder).

Table 7. PCR amplification results of NRPS, PKS-I and PKS-II gene regions of test isolates.

No	Test isolates	NRPS	PKS-I	PKS-II
1	SL05	+	−	−
2	SL13	+	+	+
3	SL19	+	+	+
4	SL20	+	+	+
5	SL21	+	−	−
6	SL27	+	+	+
7	SL30	+	+	−
8	SL31	+	+	+
9	SL32	+	−	−
10	SL34	+	−	−
11	SL35	+	+	−
12	SL37	+	+	+
13	SL38	+	+	+
14	SL39	+	+	+
15	SL41	+	−	+
16	SL42	+	−	−
17	SL44	+	−	+
18	SL48	+	+	+
19	SL49	+	+	+
20	SL51	+	−	−
21	SL52	+	+	+
22	SL53	+	+	−
23	SL54	+	−	−
24	SL59	+	+	+
25	SL62	+	+	+
26	SL64	+	+	−
27	SL65	+	−	+
28	SL66	+	−	−
29	SL67	+	+	+
30	SL68	+	−	−
31	SL77	+	+	+
32	SL78	+	−	+
33	SL80	+	−	+
34	SL84	+	−	−
35	SL86	+	+	+
36	SL87	+	+	−
37	SL88	+	+	−
38	SL92	+	+	+
39	SL93	+	−	−
40	SL97	+	+	−
41	SL98	+	−	−
42	SL100	+	−	−
43	SL101	+	+	−
44	SL102	+	+	−
45	SL103	+	−	−
46	SL105	+	−	−
47	SL108	+	+	−
48	SL109	+	+	−

‘+’ Represent PCR screening for target genes is positive and ‘−’ is that of negative.

Hayakawa M, Nonomura H. Humic acid-vitamin agar, a new medium for the selective isolation of soil actinomycetes. J Ferment Technol. 1987;65(5):501–509.

 Google Scholar

Kuester E, Williams ST. Selection of media for isolation of streptomycetes. Nature. 1964;202:928–929.

 PubMed Web of Science ®Google Scholar

Sanglier JJ, Whitehead D, Saddler GS, et al. Pyrolysis mass spectrometry as a method for the classification, identification and selection of actinomycetes. Gene. 1992;115(1-2):235–242.

 PubMed Web of Science ®Google Scholar

Tan GYA, Ward AC, Goodfellow M. Exploration of Amycolatopsis diversity in soil using genus-specific primers and novel selective media. Syst Appl Microbiol. 2006;29(7):557–569.

 PubMed Web of Science ®Google Scholar

Reasoner DJ, Geldreich EE. A new medium for the enumeration and subculture of bacteria from potable water. Appl Environ Microbiol. 1985;49(1):1–7.

 PubMed Web of Science ®Google Scholar

Mincer TJ, Jensen PR, Kauffman CA, et al. Widespread and persistent populations of a major new marine actinomycete taxon in ocean sediments. Appl Environ Microbiol. 2002;68(10):5005–5011.

 PubMed Web of Science ®Google Scholar

Jiang Y, Li Q, Chen X, et al. Isolation and cultivation methods of actinobactera. In: Dhanasekaran D, editor. Actinobacteria–basics and biotechnological application. London (UK): IntechOpen; 2016. p. 39–57.

 Google Scholar

Weisburg WG, Barns SM, Pelletier DA, et al. 16S ribosomal DNA amplification for phylogenetic study. J Bacteriol. 1991;173(2):697–703.

 PubMed Web of Science ®Google Scholar

Buchholz-Cleven BEE, Rattunde B, Straub KL. Screening for genetic diversity of isolates of anaerobic Fe(II)-oxidizing bacteria using DGGE and whole-cell hybridization. Syst Appl Microbiol. 1997;20(2):301–309.

 Web of Science ®Google Scholar

Chun J, Goodfellow M. A phylogenetic analysis of the genus Nocardia with 16S rRNA gene sequences. Int J Syst Bacteriol. 1995;45(2):240–245.

 PubMedGoogle Scholar

Ayuso-Sacido A, Genilloud O. New PCR primers for the screening of NRPS and PKS-I systems in actinomycetes: detection and distribution of these biosynthetic gene sequences in major taxonomic groups. Microb Ecol. 2005;49(1):10–24.

 PubMed Web of Science ®Google Scholar

Metsä-Ketelä M, Salo V, Halo L, et al. An efficient approach for screening minimal PKS genes from Streptomyces. FEMS Microbiol Lett. 1999;180(1):1–6.

 PubMed Web of Science ®Google Scholar

Saitou N, Nei M. The neighbor-joining method. A new method for reconstructing phylogenetic trees. Mol Biol Evol. 1987;4:406–425.

 PubMed Web of Science ®Google Scholar

Data availability

All data that support the findings reported in this study are available from the corresponding author upon reasonable request.