Combined diabetes and chronic stress exacerbates cytokine production and oxidative stress in rat liver and kidney

Figures & data

Table 1. Primer sequences used for real-time quantitative reverse transcriptase polymerase chain reaction (qRT-PCR).

	Forward	Reverse
IL-6	GAAACGGAACTCCAGAAGACC	GACTGCCTTCCCTACTTCACA
TNF-α	TGTTCATCCGTTCTCTACCC	TTGCACCCTGAGCCACAA
18S rRNA	AGTCGGCATCGTTTATGGTC	TGAGGCCATGATTAAGAGGG

Table 2. Biochemical serum parameters from control and treated rats.

	Fasting blood glucose (mg/dL)	AST (U/L)	ALT (U/L)	Urea (mmol/L)	Creatinine (µmol/L)	CRP (mg/L)
CTRL	118.22 ± 11.04	31.74 ± 9.24	22.59 ± 5.39	5.17 ± 2.49	31.88 ± 7.88	5.33 ± 1.97
DM	240.45 ± 13.24**	62.14 ± 7.48**	36.61 ± 8.11**	16.39 ± 3.51**	54.03 ± 5.41**	16.73 ± 3.82**
UCMS	133.47 ± 9.5	28.11 ± 12.44 ≠	25.88 ± 12.75≠	6.59 ± 1.05≠≠	36.77 ± 10.29≠≠	7.05 ± 3.11≠
DM + UCMS	267.75 ± 11.74** ≠	70.94 ± 10.17**##	54.91 ± 9.49**##≠≠	17.82 ± 3.37** #	52.89 ± 8.86** #	23.55 ± 4.47** ≠≠ ##

AST: Aspartate aminotransferase, ALT: Alanine aminotransferase, CRP: C-reactive protein.

Data are mean ± SEM. **p < 0.01 versus CRTL, ≠ p < 0.05, ≠≠ p < 0.01 versus DM, # p < 0.05, ## p < 0.01 versus UCMS. CTRL: control group, DM: Alloxan_induced diabetic rats, UCMS: unpredictable chronic mild stress group, DM + UCMS: combined group.

Figure 1. Real-time RT-PCR analysis of IL-6 and TNF-α mRNA in liver (A, B) and kidney (C, D) from control and treated rats. Values are presented as ratio fold change of mRNA to control group. Data are mean ± SEM. *p < 0.05, **p < 0.01 versus CTRL; ≠ p < 0.05, ≠ ≠ p < 0.01 versus DM. CTRL: control group, DM: Alloxan-induced diabetic rats, UCMS: unpredictable chronic mild stress group, DM + UCMS: combined group.

Figure 2. Levels of proinflammatory cytokines, IL-6 and TNF-α in liver (A, B) and kidney (C, D) determined by ELISA. Data are mean ± SEM. *p < 0.05, **p < 0.01 versus CTRL; ≠ ≠ p < 0.01 versus DM; # p < 0.05, ## p < 0.01 versus UCMS. CTRL: control group, DM: Alloxan-induced diabetic rats, UCMS: unpredictable chronic mild stress group, DM + UCMS: combined group.

Figure 3. Antioxidant enzymes activities, SOD (A), CAT (B) and MDA level (C) in liver and kidney from control and treated rats. Data are mean ± SEM. **p < 0.01 versus CTRL; ≠ ≠ p < 0.01 versus DM; # p < 0.05, ## p < 0.01 versus UCMS. CTRL: control group, DM: Alloxan-induced diabetic rats, UCMS: unpredictable chronic mild stress group, DM + UCMS: combined group.

Data availability statement

The data that support the findings of this study are available at from the corresponding author, upon reasonable request.