Relationship between bladder cancer and polymorphisms of OX40 (rs17568) and OX40L (rs1234313) genes in a Turkish population

Figures & data

Table 1. Using primers and restriction enzymes for the detection of OX40 and Ox40L genotypes.

Polymorphic site	Primers	Annealing temperature/cycle number	Restriction enzymes for PCR product	Restriction temperature/time	PCR product	Genotypes: base pairs
OX40 rs17568	F; TGTGGTAGATGCTGCCTGTG	59 °C/35	BsmA1	55 °C/2 h	359bp	AA:198bp + 161bp AG:359bp + 198bp + 161bp GG:359bp
	R; CCCTTCTCCTATTCGGGTTG
OX40L rs1234313	F; GGGAATTGCCACACTGTCTT	60 °C/35	Tail1	65 °C/2 h	329bp	AA:329bp AG:329 + 176bp + 153bp GG:176bp + 153bp
	R; CCTTGCCATACCTCCTACCA

Figure 1. Genotyping gel images. Gel images of genotyping analysis of the OX40 (rs17568) gene (A) and the OX40L (rs1234313) gene (B). 100-bp DNA Ladder (New England BioLabs, N3231) was used.

Table 2. Genotype frequencies of Ox40 rs17568 and Ox40L rs1234313 gene variants in patients with bladder cancer and controls.

	Bladder cancer patients, n (%)	Healthy controls, n (%)	p-Value
Ox40 rs17568
AA	58 (55.8)	49 (50.5)	0.256
AG	40 (38.5)	36 (37.1)
GG	6 (5.8)	12 (12.4)
A	156 (75)	134(69.07)	0.185
G	52 (25)	60 (30.92)
Ox40L rs1234313
AA	8 (7.7)	6 (6.2)	0.023
AG	50 (48.1)	65 (67)
GG	46 (44.2)	26 (26.8)
A	66 (31.73)	77 (39.69)	0.09
G	142 (68.26)	117 (60.3)

n, number of individuals.

Table 3. Distribution of Ox40 and Ox40L genotypes according to tumour histopathological characteristics.

	T2 invasive (n%)	Ta and T1 (n%)	High grade	Low grade
Ox40 rs17568
AA	2 (33.3)	47 (54.7)	32 (53.3)	17 (53.1)
AG	4 (66.7)	33 (38.4)	24 (40.0)	13 (40.6)
GG	0 (0)	6 (7.0)	4 (6.7)	2 (6.3)
p-value	0.365		0.996
Ox40L rs1234313
AA	1 (16.7)	7 (8.1)	5 (8.3)	3 (9.4)
AG	5 (83.3)	36 (41.9)	25 (41.7)	16 (50.0)
GG	0 (0)	43 (50.0)	30 (50.0)	13 (40.6)
p-value	0.060		0.689

Table 4. OX40 rs17568 /OX40L rs1234313 allele frequencies and bladder cancer patient’s histopathological characteristics.

OX40 rs17568	AAAG	GG	P	OR (95% CI)	GGAG	AA	p	OR (95% CI)	AAGG	AG	p	OR (95% CI)
Patient groups	98 (94.2%)	6 (5.8%)	0.101	2.306 (0.830–6.408)	46 (44.2%)	58 (55.8%)	0.456	0.810 (0.465-1.411)	64 (61.5%)	40 (38.5%)	0.844	1.059 (0.598–1.874)
Control groups	85 (87.6%)	12 (12.4%)			48 (49.5%)	49 (50.5%)			61 (62.9%)	36 (37.1%)
T2 invasive	6 (100.0%)	0 (0.0%)	0.503	–	4 (66.7%)	2 (33.3%)	0.413	2.410 (0.419–13.865)	2 (33.3%)	4 (66.7%)	0.215	3.212 (0.557–18.524)
Ta veT1	80 (93.0%)	6 (7.0%)			39 (45.3%)	47 (54.7%)			53 (61.6%)	33 (38.4%)
High grade	56 (93.3%)	4 (6.7%)	1	0.933 (0.161–5.394)	28 (46.7%)	32 (53.3%)	0.985	0.992 (0.420–2.343)	36 (60.0%)	24 (40.0%)	0.954	0.974 (0.406–2.336)
Low grade	30 (93.8%)	2 (6.2%)			15 (46.9%)	17 (53.1%)			19 (59.4%)	13 (40.6%)
OX40L rs1234313	AAAG	GG	P	OR (95% CI)	AGGG	AA	P	OR (95% CI)	AAGG	AG	p	OR (95% CI)
Patient groups	58 (55.8%)	46 (44.2%)	0.01	0.462 (0.255–0.835)	96 (92.3%)	8 (7.7%)	0.675	0.791 (0.264–2.369)	54 (51.9%)	50 (48.1%)	0.007	0.456 (0.257–0.808)
Control groups	71 (73.2%)	26 (26.8%)			91 (93.8%)	6 (6.2%)			32 (33.0%)	65 (67.0%)
T2 invasive	6 (100.0%)	0 (0.0%)	0.028	–	5 (83.3%)	1 (16.7%)	0.474	0.443 (0.045–4.340)	1 (16.7%)	5 (83.3%)	0.085	6.944 (0.778–62.010)
Ta veT1	43 (50.0%)	43 (50.0%)			79 (91.9%)	7 (8.1%)			50 (58.1%)	36 (41.9%)
High grade	30 (50.0%)	30 (50.0%)	0.391	0.684 (0.287–1.630)	55 (91.7%)	5 (8.3%)	1	1.138 (0.254–5.102)	35 (58.3%)	25 (41.7%)	0.444	0.714 (0.302–1.692)
Low grade	19 (59.4%)	13 (40.6%)			29 (90.6%)	3 (9.4%)			16 (50.0%)	16 (50.0%)

Bold values denote statistical significance at the p < 0.05 level.

Table 5. OX40 rs17568 and OX40L rs1234313 combined genotyping results.

	OX40/OX40L genotype combinations									p
	AAAA	AAAG	AAGG	AGAA	AGAG	AGGG	GGAA	GGAG	GGGG
Patient groups	3 (2.9%)	29 (27.9%)	26 (25.0%)	4 (3.8%)	20 (19.2%)	16 (15.4%)	1 (1.0%)	1 (1.0%)	4 (3.8%)	*
Control groups	4 (4.1%)	31 (32.0%)	14 (14.4%)	1 (1.0%)	26 (26.8%)	9 (9.3%)	1 (1.0%)	8 (8.2%)	3 (3.1%)

Data availability statement

The data that support the findings of this study are available from the corresponding author, [LV], upon reasonable request.