Leber’s hereditary optic neuropathy: clinical and genetic analysis of Bulgarian patients

Figures & data

Table 1. Validated primers to amplify the complete mtDNA.

Fragment 1	F-tagccatgcactactcaccaga
	R-ggatgaggcaggaatcaaagac
Fragment 2	F-ctgtatccgacatctggttcct
	R-gtttagctcagagcggtcaagt
Fragment 3	F-acttaagggtcgaaggtggatt
	R-tcgatgttgaagcctgagacta
Fragment 4	F-aagtcaccctagccatcattcta
	R-gatatcatagctcagaccatacc
Fragment 5	F-ctgctggcatcactatactacta
	R-gattggtgggtcattatgtgttg
Fragment 6	F-cttaccacaaggcacacctaca
	R- ggcacaatattggctaagaggg
Fragment 7	F-gtctggcctatgagtgactaca
	R-cagttcttgtgagctttctcgg
Fragment 8	F-ctccctctacatatttaccacaac
	R-aagtcctaggaaagtgacagcga
Fragment 9	F-gcaggaatacctttcctcacag
	R-gtgcaagaataggaggtggagt

Table 2. Distribution of patients with LHON (n = 22) according to age of onset of first symptoms of the disease.

Age at first onset of symptoms (years)	Number of LHON patients (n = 22)
0–10	5
10–20	10
20–30	2
30–43	5

Table 3. Distribution of visual acuity in patients with LHON (n = 22).

Visual acuity	Patients with LHON (n = 22)
0.6 − 0.9	2
0.1 − 0.5	9
0.05 − 0.09	1
Less than 0.05	10

Figure 1. Bilateral central scotomas in the visual field of a patient, 28 years old, with LHON.

Figure 2. Photograph of the fundus of the eye of a patient, age 16 years, with LHON in the acute stage, showing mild hyperemia of the optic disc and tortuosity of the retinal vessels [24].

Figure 3. Optical coherence tomography in a patient with LHON – data on manifest ‘thinning’ of the retinal neuro-fibre layer in both eyes.

Table 4. Distribution of LHON patients (n = 22) according to the type of mutation causing the disease.

mtDNA mutation	Gene	Patients with LHON (n = 22)
G11778A, p.R340H	MT-ND4	9
G3460A, p.A52T	MT-ND1	3
G3635A, p.S110N	MT-ND1	5
G11778A, p.R340H T14484C, p.M64V	MT-ND4 MT-ND6	3
А15988G	МТ-ТР	1
С4640А, р.I57M	MT-ND2	1

Figure 4. A family with LHON with five affected individuals (four of them previously reported [24]) with the G3635A, p. S110N mutation in MT-ND1.

Cherninkova S, Zaharova B, Sareva R, et al. Clinical symptoms and genetic studies in patients with Leber’s hereditary optic neuropathy. Bulg Neurol. 2016;17(3):226– 233.

 Google Scholar

Data availability statement

The anonymized data that support the findings of this study are available on request from the corresponding author [S.C.]. The data are not publicly available due to privacy or ethical restrictions.