Bacillus velezensis R22 inhibits the growth of multiple fungal phytopathogens by producing surfactin and four fengycin homologues

Figures & data

Table 1. Primers used for the amplification and sequencing of gene fragments from nonribosomal peptide synthetases.

Primer	Sequence (5’-3’)	PCR product	Position	T, °C
fenA_F fenA_R	Gcggtcaagctttccgctcggtgtgac ctgtttatggcttcgttatacatatgcatcagc	2103 bp	4815 − 4842^a 6879 − 6912^a	63.0
sur_F sur_R	ggctgagagcatcgcaccggcggccgagcg Aacggatggtgcttcagctcaattccttcc	1110 bp	6263 − 6293^a 7343 − 7373^a	55.8
lic_F lic_R	cgatagtgatggagcggtcagagcgggtca Cttgttcagctccgagcacttcctgccata	1440 bp	1540 − 1570^b 2950 − 2980^b	60.0

T, °C is the used temperature of annealing.

^a Position in the genome of B. velezensis FZB42 (Region 1,961,346–1,963,824; GenBank acc. no. CP000560).

^b Position in the genome of B. licheniformis ATCC 14580 (Region 370,023–408,881; GenBank acc. no. AE017333.1).

Figure 1. Phylogenetic tree of Bacillus spp. based on 16S rRNA sequences through maximum-likelihood methods with 1000 bootstrap replications using MEGA version 6.0. Escherichia coli BL21(DE3) (AM946981.2) was used as an outgroup in the analysis. NCBI GenBank accession numbers used in the comparison reference strains are the following: B. velezensis FZB42, OR485707; B. amyloliquefaciens ATCC 23350, NR_118950; B. licheniformis ATCC 14580, NC_006270.3; B. aerius MN-1, MN252912; B. safensis ATCC BAA-1126^T, AF234854; B. aryabhattai B8W22, NZ_JYOO01000023. NCBI acc. no. of the newly isolated strains are OR482395, OR482394, OR482396, OR482397, OP554433, MK461937, MK461933, MK461938, MK461934, MK461936, OR482398, OR482400, OR482399, MK461947.

Table 2. Inhibition of Botrytis cinerea growth by cell-free supernatant of Bacillus spp. cultures obtained after 48 h of cultivation.

Species	Strain	Inhibition zone (mm)
B. velezensis	R22	34 ± 3
B. aryabhattai	17М	29 ± 3
B. velezensis	R23	25 ± 3
B. aerius	1p/11	25 ± 3
B. velezensis	R19	25 ± 2
B. amyloliquefaciens	R10	25 ± 2
B. velezensis	R7	24 ± 2
B. licheniformis	39	24 ± 2
B. licheniformis	24	21 ± 2
B. licheniformis	13	21 ± 2
B. aerius	22M	20 ± 2
B. licheniformis	55-1	20 ± 2
B. licheniformis	16-1	19 ± 1
B. safensis	14-A	16 ± 1
Control	Nutrient broth	0

Table 3. Inhibition of Phytophthora infestans growth by the cell-free supernatants of 48-h Bacillus spp. cultures.

Species	Strain	Inhibition (%)
		24 h	48 h
B. licheniformis	39	93.64	91.8
B. velezensis	R22	88.06	86.02
B. aerius	22M	87.03	84.89
B. aerius	1p/11	88.28	84.25
B. velezensis	R7	87.16	84.64
B. safensis	14-A	87.28	83.87
B. aryabhattai	17М	85.65	81.46
B. amyloliquefaciens	R10	84.65	80.58
B. licheniformis	13	84.19	79.32
B. velezensis	R23	81.45	76.42
B. velezensis	R19	80.69	76.01
B. licheniformis	55-1	78.18	75.05
B. licheniformis	24	75.94	71.63
B. licheniformis	16-1	74.31	70.24
Control	Nutrient broth	–	–

Table 4. Comparison of the antifungal activity against Phytophthora infestans displayed by B. velezensis R22 (BV R22) and B. licheniformis 39 (BL 39).

Strain	24 h		48 h		72 h		7 days
	D (cm)	AI (%)	D (cm)	AI (%)	D (cm)	AI (%)	D (cm)	AI (%)
BV R22	0.9 ± 0.1	43.8	1.5 ± 0.1	63.4	1.5 ± 0.1	76.9	1.5 ± 0.1	82.35
BL 39	0.9 ± 0.1	43.8	1.7 ± 0.1	58.5	1.6	75.4	1.6 ± 0.1	81.18
Control	1.6 ± 0.1	–	4.1 ± 0.1	–	6.5 ± 0.2	–	8.5 ± 0.1	–

D, colony diameter; AI, Antifungal index = (1 − D_sample/D_control) × 100.

Figure 2. Antifungal activity of B. velezensis R22 against phytopathogenic fungi. (A) Alternaria alternata; (B) Aspergillus fumigatus; (C) Aspergillus niger; (D) Neocosmospora keratoplastica. The co-inoculation experiments were performed in 100 mm Petri dishes for 7 days.

Table 5. Inhibition of R. solanacearum growth by cell-free supernatant of Bacillus spp. cultures obtained after 48 h of cultivation.

Species	Strain	Inhibition zone (mm)
B. velezensis	R22	29 ± 3
B. velezensis	R23	25 ± 3
B. velezensis	R19	25 ± 2
B. velezensis	R7	20 ± 2
B. licheniformis	39	20 ± 2
Control	Nutrient broth	–

Figure 3. PCR amplification of fenA gene encoding fengycin synthetase A. Designations: M, molecular weight marker (Perfect Plus^TM 1 kb DNA Ladder, EURx); 1, B. velezensis R7; 2, B. amyloliquefaciens R10; 3, B. velezensis R19; 4, B. velezensis R22; 5, B. velezensis R23; 6, negative control (E. coli DH5α).

Figure 4. PCR amplification of specific fragments of srfAA gene encoding surfactin synthetase A (A) and lchAA gene for lichenysin synthase (B). Lanes and samples: M, molecular weight marker (Perfect Plus^TM 1 kb DNA Ladder, EURx); (A): 1, B. velezensis R7; 2, B. amyloliquefaciens R10; 3, B. velezensis R19; 4, B. velezensis R22; 5, B. velezensis R23; 6, negative control (E. coli DH5α); (B) 1, B. licheniformis 16-1; 2, B. licheniformis 13; 3, B. licheniformis 24; 4, B. licheniformis 39; 5, B. licheniformis 55-1; 6, negative control (E. coli DH5α).

Table 6. Secondary metabolites predicted to be synthesized by B. velezensis R22 using AntiSMASH 7.0 platform.

Contig^a	Cluster	Region	Start (5′-3′)	End (5′-3′)	Compound	Type	Similarity (%)
1	1	1.1	543594	635972	Difficidin	Polyketide	100%
		1.2	809338	848988
		1.3	901349	921477
1	2	1.4	988641	1123173	Fengycin	Lipopeptide	100%
1	3	1.5	1193075	1293617	Bacillaene	Polyketide/lipopeptide	100%
1	4	1.6	1512777	1600983	Macrolactin Н	Polyketide	100%
1	5	1.7	1922542	1943282	Butyrosin А/В	Saccharide	7%
2	6	2.1	142895	194687	Bacillibactin	Lipopeptide	100%
2	7	2.2	720547	761965	Bacilysin	–	100%
3	8	3.1	191350	256757	Surfactin	Lipopeptide	82%
4	9	4.1	143567	194775	Macrolactin R22	Polyketide	40%
5		5.1	46224	58365	Phosphonate	–
5	10	5.2	86835	116957	Velezensin	Polyketide	–

^a Contigs’ numbering is according to the genome of B. velezensis R22 deposited in NCBI GenBank (accession no. JASUZW000000000.1, BioSample SAMN35683875).

Figure 5. Analyses of lipopeptides of B. velezensis strain R22 by UHPLC-Q-TOF mass spectrometer. (A) The total ion chromatogram of 10 μL lipopeptides extracted from the cell-free supenatant obtained after B. velezensis strain R22 growth, identified at λ 226 nm in the range m/z 150–3500; (B) LC-MS of a peak eluted between 14.7 and 16.3 min, predominant [M + H]⁺ ion at m/z 1036.698 corresponding to surfactin; (C) LC-MS of peak eluted between 4.4 and 5.9 min dominated by double charged ions [M + 2H]²⁺ at m/z 732.405, 739.412, 746.419, and 753.427 corresponding to [M + H]⁺ ions at m/z 1463.804, 1477.818, 1491.832, and 1505.849, identified as different forms of fengycin.

Figure 6. LC-MS/MS spectrum of the surfactin precursor [M + H]⁺ at m/z 1036.698, containing a C15 β-hydroxy fatty acid chain with interpretation.

Figure 7. LC-MS/MS spectra of different forms of fengycin: (A) the precursor [M + 2H]²⁺ at m/z 732.405, containing Ala of position 6 and C16 β-hydroxy fatty acid chain; (B) the precursor [M + 2H]²⁺ at m/z 739.412, containing Ala of position 6 and C17 β-hydroxy fatty acid chain; (C) the precursor [M + 2H]²⁺ at m/z 746.419, containing Val of position 6 and C16 β-hydroxy fatty acid chain; (D) the precursor [M + 2H]²⁺ at m/z 753.427, containing Val of position 6 and C17 β-hydroxy fatty acid chain.

Table 7. Lipopeptides established by mass spectrometry in cell-free fermentation broth (48-h culture) of B. velezensis strain R22.

No	[M + H]^+ (m/z)	Intensity	[M + 2H]^2^+ (m/z)	Lipopeptide family	Type	Sequence
1	1036.698	6 × 10^6	518.849	Surfactin	C15, Leu7
2	1463.804	3 × 10^5	732.405	Fengycin A	C16, Ala6
3	1477.804	2.5 × 10^5	739.412	Fengycin A	C17, Ala6
4	1491.832	1.5 × 10^5	746.419	Fengycin B	C16, Val6
5	1505.849	1 × 10^5	753.427	Fengycin B	C17, Val6

Data availability

All data concerning nucleotide sequences are available in the NCBI GenBank. De novo sequenced genome of B. velezensis strain R22 has been deposited in DDBJ/ENA/GenBank under accession no. JASUZW000000000.1, BioSample SAMN35683875. The version described in this article is the first version. The Sequence Read Archive is deposited under accession no SRP441980.