A novel TaqMan qPCR system for the detection of Diaporthe citri, the causative agent of citrus melanose

Figures & data

Table 1. Information on selected fungal strains in this study.

Strain code	Species	Host	Organ	Location	Reference
1	Diaporthe citri	Citrus reticulata cv. Succosa	Twig	Huangyan	Huang et al. [22]
2	D. citri	Citrus unshiu	Fruit	Linhai	Huang et al. [22]
3	D. citri	Citrus reticulata cv. Ponkan	Fruit	Kecheng	Huang et al. [22]
4	Colletotrichum gloeosporioides	Citrus unshiu	Leaf	Kecheng	Huang et al. [23]
5	C. gloeosporioides	Citrus reticulata cv. Succosa	Fruit	Huangyan,	Huang et al. [23]
6	D. lithocarpus	Citrus reticulata cv. Ponkan	Leaf	Huangyan,	Gao et al. [28]
7	Diplodia natalensis	Citrus reticulata cv. Ponkan	Fruit	Huangyan,	Luo et al. [24] Phillips et al. [25]
8	Guignardia citricarpa	Citrus reticulata cv. Succosa	Fruit	Huangyan,	Wulandari et al. [26]
9	D. nobilis	Citrus reticulata cv. Ponkan	Leaf	Huangyan,	Li et al. [27]

Table 2. Primers and TaqMan probes designed in this study.

Gene	Primer	Direction	Sequence (5’-3’)	Length (bp)	Product length (bp)
Beta-tubulin (TUB)	DcitTUB-F	Forward	CATCCATTTGACCATCTG	18	95
	DcitTUB-R	Reverse	CGAGGAACATACTTGTTG	18
	DcitTUB-P	Probe	5′- (FAM) TCGCTCGGACCTTGCTAACG (BHQ1) −3′	20

Table 3. DNA extraction kits used for the extraction of DNA from conidia.

DNA extraction method	Kit	Scope	Cat. No.	Company
Dingguo	CTAB plant DNA extraction kit	Plant, fungi	NEP003-1	Beijing DingguoChangsheng Biotechnology Co., Ltd
Tiangen	CTAB plant DNA extraction kit	Plant, fungi	Dp350	Beijing Tiangen Biotechnology Co., Ltd
Qiagen	DNeasyPowerSoil kit	Soil microbes	12888-50	Qiagen Inc.
Sangon	MagicMag Micro Genomic DNA Extraction Kit	Fungi, bacteria, blood	B518749-0050	Shanghai Sangon Biotechnology Co., Ltd

Figure 1. Screening and optimization of D. citri primers. (A) Specific amplification via the primers DcitTUB-F/DcitTUB-R for D. citri; agarose gel electrophoresis parameters: 25 min, 110 V, 1.5% agarose gel. M: DL2000 DNA Marker (TaKaRa, Dalian Co., Ltd.); Lanes 1–3: D. citri; Lane 4: Colletotrichum gloeosporioides; Lane 5: C. gloeosporioides; Lane 6: D. lithocarpus; Lane 7: Diplodia natalensis Evans; Lane 8: Guignardia citricarpa; Lane 9: D. nobilis; Lane 10: Asymptomatic citrus leaves. (B) Curves for determination of the optimal annealing temperature for the primer pair DcitTUB-F/DcitTUB-R.

Figure 2. Analysis of the LOD and LOQ of the plasmid standard DNA using the curve-fitting modelling approach. (A) Calibration curve plot of Cq values vs. standard concentrations. (B) LOQ plot with Coefficient of variation (CV) vs. standard concentrations.

Table 4. Comparison of different methods for the extraction of DNA from fungal conidia.

DNA extraction method	Conidia concentration (number per mL)
	5.4E + 07	1.1E + 07	2.1E + 06	4.3E + 05	8.6E + 04	1.7E + 04	3.4E + 03	6.9E + 02	3.4E + 01
Dingguo	3(3)^a	3(3)	3(3)	3(3)	3(3)	3(0)	3(0)	3(0)	3(0)
Tiangen	3(3)	3(3)	3(3)	3(3)	3(3)	3(0)	3(0)	3(0)	3(0)
Qiagen	3(3)	3(3)	3(3)	3(3)	3(3)	3(2)	3(1)	3(0)	3(0)
Sangon	3(3)	3(3)	3(3)	3(3)	3(3)	3(3)	3(3)	3(3)	3(0)

^a Number of experimental repetitions (the number of successful detections by qPCR).

Figure 3. Linear regression of the log₁₀(conidia number) against Cq values.

Figure 4. TaqMan qPCR detection of leaf samples with symptoms of citrus melanose and airborne conidia from an orchard. A and B: positive control; C–H: leaf samples; I and J: airborne conidia captured using a TPBZ3 conidia trap in a citrus orchard; K: ddH₂O; L and M: airborne conidia captured using a TPBZ3 conidia trap in a tea garden.

Huang F, Hou X, Dewdney MM, et al. Diaporthe species occurring on citrus in China. Fungal Divers. 2013a;61(1):237–250. doi: 10.1007/s13225-013-0245-6.

 Web of Science ®Google Scholar

Huang F, Chen GQ, Hou X, et al. Colletotrichum species associated with cultivated citrus in China. Fungal Divers. 2013b;61(1):61–74. doi: 10.1007/s13225-013-0232-y.

 Web of Science ®Google Scholar

Gao YH, Su YY, Sun W, et al. Diaporthe species occurring on lithocarpus glabra in China, with descriptions of five new species. Fungal Biol. 2015;119(5):295–309. doi: 10.1016/j.funbio.2014.06.006.

 PubMed Web of Science ®Google Scholar

Luo M, Dong ZY, Bin SY, et al. First report of fruit rot disease on pomelo caused by Lasiodiplodia theobromae in China. Plant Dis. 2011;95(9):1190–1190. doi: 10.1094/PDIS-03-11-0214.

 PubMed Web of Science ®Google Scholar

Phillips AJL, Alves A, Abdollahzadeh J, et al. The Botryosphaeriaceae: genera and species known from culture. Stud Mycol. 2013;76(1):51–167. doi: 10.3114/sim0021.

 PubMed Web of Science ®Google Scholar

Wulandari NF, To-Anun C, Hyde KD, et al. Phyllosticta citriasiana sp. nov., the cause of citrus tan spot of citrus maxima in Asia. Fungal Divers. 2009;34:23–39.

 Web of Science ®Google Scholar

Li Y, Tan P, Zhao DG. Diaporthe nobilis, a new record on camellia sinensis in Guizhou province, China. Mycosphere. 2017;8(1):1–8. doi: 10.5943/mycosphere/8/1/1.

 Web of Science ®Google Scholar

Data availability statement

All data that support the findings reported in this study are available from the corresponding author(Z.D.H.)upon reasonable request.