Age-associated changes in GSH S-transferase gene/proteins in livers of rats

Figures & data

Table 1. Rat primer sequences used for real-time RT-PCR analysis.

Gene	Accession#	Sequence (5′–3′)		Product length (bp)
		Forward primer	Reverse primer
β-actin	NM_031144.3	ggagattactgccctggctccta	gactcatcgtactcctgcttgctg	150
GST-A1	NM_001024361	aagcaaatatcgccctgatg	tgttcccaacgaggtagtcc	102
GST-A4	NM_001106840	cgggatgctactgacacaga	cggcatacatgtcaatcctg	107
GST-T1	NM_053293	ctgaccatgatccagtgacg	ctagcatgggaaaagggtga	137
GST-T2	NM_012796	gcaatccgtctacaccacct	aaaggggatgccattcttct	123
GST-O1	NM_001007602	tcttatttggccgtggtttc	cggtaggtcttggcatcaat	144
GST-M1	NM_017014	ccacatttttgagcccaagt	tactccattgggccaacttc	149
GST-M3	NM_020540	agaaccaggtcatggacacc	atcttctccgggatggactt	103
GST-P1	NM_012577	tatgccaccgtacaccattg	gagccttgaagccagacatc	129
GST-K1	NM_181371	cacggagtcccagaacattt	tctccctgagcttgctcttc	116
GST-Z1	NM_001109445	cacacatggtgttggagagg	ggaaccggctttaaggtttc	113

Figure 1. Age-related expression of GSTA1 and GSTA4 in livers of rats. Livers from male SD rats at the fetus (−2 d before birth), the neonatal stage (1, 7, 14 and 21 d after birth), at puberty (28 and 35 d), at adult (60 and 180 d), and at aging (540 and 800 d), were collected to extract RNA. Expression of GST-A1 and GST-A4 was determined by real-time RT-PCR (n = 6 for each time point).

Figure 2. Age-related expression of GSTM1and GSTM3 in livers of rats. Livers from male SD rats at the fetus (−2 d before birth), the neonatal stage (1, 7, 14 and 21 d after birth), at puberty (28 and 35 d), at adult (60 and 180 d), and at aging (540 and 800 d), were collected to extract RNA. Expression of GSTM1 and GSTM3 was determined by real-time RT-PCR (n = 6 for each time point).

Figure 3. Age-related expression of GSTT1and GSTT2 in livers of rats. Livers from male SD rats at the fetus (−2 d before birth), the neonatal stage (1, 7, 14 and 21 d after birth), at puberty (28 and 35 d), at adult (60 and 180 d), and at aging (540 and 800 d), were collected to extract RNA. Expression of GSTT1 and GSTT3 was determined by real-time RT-PCR (n = 6 for each time point).

Figure 4. Age-related expression of GSTK1and GSTO1 in livers of rats. Livers from male SD rats at the fetus (−2 d before birth), the neonatal stage (1, 7, 14 and 21 d after birth), at puberty (28 and 35 d), at adult (60 and 180 d), and at aging (540 and 800 d), were collected to extract RNA. Expression of GSTK1 and GSTO1 was determined by real-time RT-PCR (n = 6 for each time point).

Figure 5. Age-related expression of GSTP1 and GSTZ1 in livers of rats. Livers from male SD rats at the fetus (−2 d before birth), the neonatal stage (1, 7, 14 and 21 d after birth), at puberty (28 and 35 d), at adult (60 and 180 d), and at aging (540 and 800 d), were collected to extract RNA. Expression of GSTP1 and GSTZ1 was determined by real-time RT-PCR (n = 6 for each time point).

Figure 6. Age-related expression of GSTA1, GSTM1 and GSTP1 in livers of rats. Livers from male SD rats at the neonatal age (14 days of age), at weanling (21 days of age), at adult (60 and 180 d), and at aging (540 and 800 d), were collected to extract protein. Expression of GSTA1, GSTM1 and GSTP1 was determined by western-blots from different blot analysis. Photos shows the representative blots from 3 separate analysis, and the statistical analysis (n = 3) was shown in the bottom. *Significant from 14 d, P < 0.05.