Modulating gut dysbiosis and mitochondrial dysfunction in oxazolone-induced ulcerative colitis: the restorative effects of β-glucan and/or celastrol

Figures & data

Table

Gene	Forward	Reverse	Accession number
FFAR-2	5′ CTACGAGAACTTC ACCCAAGAG 3′	5′ GAAGCGCCAATAACAGAAGATG 3′	XM_039104536.1
PGC-1α	5′ GTGCAGCCAAGACTCTGTATGG 3`	5′ GTCCAGGTCATTCACATCAAGTTC3`	XM_039092489.1
GADPH	5’ CAACTCCCTCAAGATTGTCAGCAA 3'	5’ GGCATGGACTGTGGTCATGA 3'	NM_001394060.2

Table 1. Effect of β-glucan and celastrol on different parameters in the studied groups.

Parameter/Groups	Group I (n = 15)	Group II (n = 15)	Group III (n = 15)	Group IV (n = 15)	Group V (n = 15)	F-value	P-value
TMAO (pmol/mg protein)	13.5 ± 2.6	122.8 ± 5.6^a	67.8 ± 9.2^a,b	76.5 ± 9.3^a,b,c	51.5 ± 10.1^a,b,c,d	379.5	<.001*
Mitochondrial ATP Concentration (nmol/mg protein)	13.7 ± 2.1	5.7 ± 1.4^a	7.6 ± 0.99^a,b	9.7 ± 079^a,b,c	11.3 ± 1.6^a,b,c,d	59.22	<.001*
Mitochondrial citrate synthase activity (IU/mL)	9.67 ± 1.6	2.1 ± 1.1^a	4.9 ± 1.03^a,b	6.2 ± 0.9^a,b,c	7.4 ± 1.06^a,b,c,d	90.23	<.001*
Mitochondrial Membrane Potential (ΔΨm) (Florescent Unit)	8.13 ± 1.1	2.4 ± 0.9^a	4.5 ± 0.8^a,b	5.9 ± 0.7^a,b,c	7 ± 1.1^a,b,c,d	86.92	<.001*

Notes: Values are expressed as mean ± SD. The number of rats in each group (n = 15). P was considered significant at <.05. a, Significance vs. Group I; b, Significance vs. Group II, c, Significance vs. Group III and d, Significance vs. Group IV, using one-way ANOVA followed by Tukey’s post hoc test for multiple comparisons.

Table 2. Effect of β-glucan and celastrol on mitochondrial reactive oxygen species in the studied groups.

Parameter/Groups	Group I (n = 15)	Group II (n = 15)	Group III (n = 15)	Group IV (n = 15)	Group V (n = 15)	Positive Control	F-value	P-value
Mitochondrial Reactive Oxygen Species (pmol/min/mg protein)	5.3 ± 0.98	20.4 ± 1.2^a	15.7 ± 1.2^a,b	13.13 ± 1.1^a,b,c	9.8 ± 0.78^a,b,c,d	25.56 ± 0.77^a,b,c,d,e	413.6	<0.001*

Notes: Values are expressed as mean ± SD. The number of rats in each group (n = 15). P was considered significant at <.05. a, Significance vs. Group I; b, Significance vs. Group II; c, Significance vs. Group III; d, Significance vs. Group IV and e, Significance vs. Group V using one-way ANOVA followed by Tukey’s post hoc test for multiple comparisons.

Table 3. Correlation between different studied parameters among the different studied groups.

	TMAO (pmol/mg protein)		Mitochondrial ATP Concentration (nmol/mg protein)		Mitochondrial citrate synthase activity (IU/mL)		Mitochondrial Membrane Potontial (ΔΨm) (Florescent Unit)		Mitochondrial reactive oxygen species (pmol/min/mg protein)
	r	P	r	P	r	P	r	P	r	P
TMAO (pmol/mg protein)	–	–	−0. 64	<.001*	−0.79	<.001*	−0.78	<.001*	0.85	<.001*
Mitochondrial ATP Concentration (nmol/mg protein)	−0. 64	<.001*	–	–	0. 72	<.001*	0.78	<.001*	−0.81	<.001*
Mitochondrial citrate synthase activity (IU/ml)	−0.79	<.001*	0. 72	<.001*		–	0.81	<.001*	−0.86	<.001*
Mitochondrial Membrane Potontial (ΔΨm) (Florescent Unit)	−0.78	<.001*	0.78	<.001*	0.81	<.001*	–	–	−0.85	<.001*
Mitochondrial reactive oxygen species (pmol/min/mg protein)	0.85	<.001*	−0.81	<.001*	−0.86	<.001*	−0.85	<.001*	–	–

*P < 0.05.

Figure 1. Graphical presentation of real-time quantitative PCR analysis of the expression of PGC-1α gene in studied groups by fold change. Means within column carrying different superscript letters are significantly different at p ≤ 0.05; a, significance vs. Group I; b, significance vs. Group II; c, significance vs. Group III; d, significance vs. Group IV.

Figure 2. Graphical presentation of real-time quantitative PCR analysis of the expression of FFAR-2 gene in studied groups by fold change. Means within column carrying different superscript letters are significantly different at p ≤ 0.05; a, significance vs. Group I; b, significance vs. Group II; c, significance vs. Group III; d, significance vs. Group IV.

Figure 3. (a) Ulcerative colitis Geboes score 2B.2 showed a marked increase in the neutrophils in the lamina propria (blue arrow, H&E ×100), (b) the same case showed score 3 Bcl-2 expressions (ABC ×100), (c) also showed score 2 expressions of Bax (ABC ×200).

Figure 4. (a) A case of UC Geboes score 4.4 showed marked epithelial injury, cryptitis (blue arrow) and ulcerations (red arrow) (H&E ×100), (b) the same case showed score 4 Bcl2 expressions (ABC ×100), (c) also showed score 4 expressions of Bax (ABC ×100).

Figure 5. (a) Normal control colon specimen (H&E ×100), (b) normal colon stained by Bcl2 score as 1 (ABC ×100), (c): normal colon stained by Bax scored 1 (ABC ×100).

Figure 6. (a) The β-Glucan-treated group showing Geboes score 3.1 in the form of cryptitis (red arrow) and neutrophils seen in some of the epithelium (H&E ×100). (b) The same case showed a score 4 Bcl2 expression (ABC ×200), (c) also showed score a 3 core expression of Bax (ABC ×200).

Figure 7. (a) The Celastrol-treated group showing Geboes score 3.2 in the form of cryptitis and neutrophils (red arrow) seen in most of the epithelium (H&E ×100). (b) The same case showed score a 2 Bcl2 expression (ABC ×200), (c) also showed a score 3 expression of Bax (ABC ×100).

Figure 8. The combined-treated group showing Geboes score 1.2 in the form of a marked increase in the basal plasma cells only (red arrow) (H&E ×200). (b) The same case showed a score 2 Bcl2 expression (ABC ×200), (c) also showed a score 1 expression of Bax (ABC ×100).