Mutations in the COL18A1 gen associated with knobloch syndrome and structural brain anomalies: a novel case report and literature review of neuroimaging findings

Figures & data

Figure 1. Color orientation 3D-tractography reconstruction of the arcuate fascicle. The patent´s right-left asymmetry evidence a shorter tract and a lower amount of nerve fibers on the left side.

Figure 2. Color-code perfusion map with the pulsed-ASL sequence. Decreased cortical blood flow in the patient´s left cerebellar hemisphere.

Figure 3. Illustration of the COL18A1 variants present in the proband by NGS and sanger sequencing and segregation studies.

A) IGV visualization of the variant COL18A1 ca. 1883_1891dup was evident in the proband and his mother, in both strands (forward in red and reverse in blue), in 26% (24/93) and 25% (16/64) of the reads, respectively. B) IGV visualization of the variant COL18A1 ca. 1787 C > T was evident in the proband and his father, in both strands (forward in red and reverse in blue), in 50% (50/101) and 56% (51/91) of the reads, respectively. C) Segregation studies of the COL18A1 ca. 1883_1891dup variant show its presence in the proband and its absence on the healthy sister (as indicated by the arrows). D) Segregation studies of the COL18A1 ca. 1787 C > T variant show its presence in the proband and in his healthy sister (as indicated by the arrow).

Figure 4. Expression of COL18A1 (total and isoforms) in peripheral blood leukocytes.

Table

Total COL18A1 (endostatin)	Forward	TGCCCATCGTCAACCTCAAG
Total COL18A1 (endostatin)	Reverse	CAGAGCCTGAGAACAGAGCC
COL18A1 short isoform	Forward	CTCCTGGACGTGCTCGC
COL18A1 short isoform	Reverse	TCATCCGTCTGGGTGACCT
COL18A1 medium isoform	Forward	GCCGTGGCATTCCTAGCTC
COL18A1 medium isoform	Reverse	CTGATGCGCTCTGAAGATGGT
COL18A1 long isoform	Forward	GCCGTGGCATTCCTAGCTC
COL18A1 long isoform	Reverse	GCTCTACCTGAAGATGGTGGT

Table 1. Neuroimaging findings in patients with biallelic COL18A1 mutations. * Cases with anomalies in brain MRI (only cases with performed and available results)

Authors [Reference number]	Number of cases	MRI findings/brain malformations	Abnormal MRI*
Current report	1	no significant structural malformations. DTI tractography: shorter tract and a lower amount of nerve fibers on the left arcuate fascicle ASL sequence: decreased cortical blood flow in the patient´s left cerebellar hemisphere.	1/1
Kliemann et al., 2003 [17]	4	1 case: normal MRI 1 case: subependymal, heterotopic nodules in the lateral ventricles 1 case: basilar impression 1 case: moderate ventricular dilatation and a pachygyric area in the right frontal lobe; heterotopic nodule on the subpendymal surface of the right lateral ventricle	3/4
Keren et al., 2007 [15]	2	1 case: agenesis of the septum pellucidum, bilateral pachygyria/polymicrogyria of the entire frontal lobes, and heterotopic hypersignals along the radial migration tracts 1 fetus: agenesis of cerebellar vermis; abnormal formation of cerebellar hemispheres; hamartomatous lesion of the mesencephalic roof	2/2
Paisan-Ruiz et al., 2009 [21]	2	2 cases: frontal polymicrogyria with cerebrum and cerebellar atrophy	2/2
Khan et al., 2012 [16]	7	1 case: heterotopic gray matter in lateral ventricles 6 cases: not available	1/1
Caglayan et al., 2014 [4]	4	2 cases: polymicrogyria of the bilateral frontal lobes 1 case: polymicrogyria involving the bilateral frontal and parietal lobes 1 case: cerebelar vermian atrophy	4/4
Hull et al., 2016 [13]	12	2 cases: normal MRI 1 case: extensive bifrontal polymicrogyria 2 cases: bifrontal polymicrogyria and encephalocele 2 case: encephalocele/meningocele 3 cases: midline occipital defect 2 cases: not available	8/10
Charsar & Goldberg, 2017 [7]	2	1 case: extensive bifrontal polymicrogyria 1 case: extensive bifrontal polymicrogyria, simplified gyral pattern; paucity of frontoparietal white matter and cerebral volume loss	2/2
White et al., 2017 [32]	2	1 case: polymicrogyria bifrontal 1 case: polymicrogyria in the inferior and middle frontal gyri bilaterally	2/2
Corbett et al., 2017 [5]	4	2 cases: frontal polymicrogyria affecting the dorsolateral surfaces predominantly 2 cases: not available	2/2
L. S. Zhang et al., 2018 [36]	2	2 cases: bilateral frontal gyrus dysplasia	2/2

Kliemann, S. E., Waetge, R. T., Suzuki, O. T., Passos-Bueno, M. R., & Rosemberg, S. (2003). Evidence of neuronal migration disorders in knobloch syndrome: Clinical and molecular analysis of two novel families. American Journal of Medical Genetics. Part A, 119A (1), 15–19. https://doi.org/https://doi.org/10.1002/ajmg.a.20070

 Web of Science ®Google Scholar

Keren, B., Suzuki, O. T., Gerard-Blanluet, M., Bremond-Gignac, D., Elmaleh, M., Titomanlio, L., Delezoide, A. L., Passos-Bueno, M. R., & Verloes, A. (2007). CNS malformations in knobloch syndrome with splice mutation in COL18A1 gene. American Journal of Medical Genetics. Part A, 143A (13), 1514–1518. https://doi.org/https://doi.org/10.1002/ajmg.a.31784

 Web of Science ®Google Scholar

Paisan-Ruiz, C., Scopes, G., Lee, P., & Houlden, H. (2009). Homozygosity mapping through whole genome analysis identifies a COL18A1 mutation in an Indian family presenting with an autosomal recessive neurological disorder. American Journal of Medical Genetics. Part B, Neuropsychiatric Genetics : The Official Publication of the International Society of Psychiatric Genetics, 150B (7), 993–997. https://doi.org/https://doi.org/10.1002/ajmg.b.30929

 Web of Science ®Google Scholar

Khan, A. O., Aldahmesh, M. A., Mohamed, J. Y., Al-Mesfer, S., & Alkuraya, F. S. (2012). The distinct ophthalmic phenotype of knobloch syndrome in children. The British Journal of Ophthalmology, 96 (6), 890–895. https://doi.org/https://doi.org/10.1136/bjophthalmol-2011-301396

 Web of Science ®Google Scholar

Caglayan, A. O., Baranoski, J. F., Aktar, F., Han, W., Tuysuz, B., Guzel, A., Guclu, B., Kaymakcalan, H., Aktekin, B., Akgumus, G. T., Murray, P. B., Erson-Omay, E. Z., Caglar, C., Bakircioglu, M., Sakalar, Y. B., Guzel, E., Demir, N., Tuncer, O., Senturk, S., Ekici, B., Gunel, M. (2014). Brain malformations associated with knobloch syndrome–review of literature, expanding clinical spectrum, and identification of novel mutations. Pediatric Neurology, 51 (6), 806–813 e808. https://doi.org/https://doi.org/10.1016/j.pediatrneurol.2014.08.025

 Web of Science ®Google Scholar

Hull, S., Arno, G., Ku, C. A., Ge, Z., Waseem, N., Chandra, A., Webster, A. R., Robson, A. G., Michaelides, M., Weleber, R. G., Davagnanam, I., Chen, R., Holder, G. E., Pennesi, M. E., & Moore, A. T. (2016). Molecular and clinical findings in patients with knobloch syndrome. JAMA Ophthalmology, 134 (7), 753–762. https://doi.org/https://doi.org/10.1001/jamaophthalmol.2016.1073

 Web of Science ®Google Scholar

Charsar, B. A., & Goldberg, E. M. (2017). Polymicrogyria and intractable epilepsy in siblings with knobloch syndrome and homozygous mutation of COL18A1. Pediatric Neurology, 76, 91–92. https://doi.org/https://doi.org/10.1016/j.pediatrneurol.2017.08.003

 PubMed Web of Science ®Google Scholar

White, R. J., Wang, Y., Tang, P., & Montezuma, S. R. (2017). Knobloch syndrome associated with polymicrogyria and early onset of retinal detachment: Two case reports. BMC Ophthalmology, 17 (1), 214. https://doi.org/https://doi.org/10.1186/s12886-017-0615-z

 Web of Science ®Google Scholar

Corbett, M. A., Turner, S. J., Gardner, A., Silver, J., Stankovich, J., Leventer, R. J., Derry, C. P., Carroll, R., Ha, T., Scheffer, I. E., Bahlo, M., Jackson, G. D., Mackey, D. A., Berkovic, S. F., & Gecz, J. (2017). Familial epilepsy with anterior polymicrogyria as a presentation of COL18A1 mutations. European Journal of Medical Genetics, 60 (8), 437–443. https://doi.org/https://doi.org/10.1016/j.ejmg.2017.06.002

 Web of Science ®Google Scholar

Zhang, L. S., Li, H. B., Zeng, J., Yang, Y., & Ding, C. (2018). Knobloch syndrome caused by homozygous frameshift mutation of the COL18A1 gene in a Chinese pedigree. International Journal of Ophthalmology, 11 (6), 918–922. https://doi.org/https://doi.org/10.18240/ijo.2018.06.04

 Web of Science ®Google Scholar