Flavonoid constituents of Dobera glabra leaves: amelioration impact against CCl₄-induced changes in the genetic materials in male rats

Figures & data

Table 1. Primer sequences used for qPCR.

Gene	Primer sequence (5′–3′)^a	References
GLAST	GGGTTTTCATTGGAGGGTTGC	(Deng et al. 2008)
	CCACGGGTTTCTCTGGTTCAT
GLT-1	GGGTCATCCTGGATGGAGGT	(Deng et al. 2008)
	CGTGTCGTCATAAACGGACTG
SNAT3	AACATCGGAGCCATGTCCAG	GenBank: NM006841
	AAGGTGAGGTAGCCGAAGAG
β-actin	GGAGATTACTGCCCTGGCTCCTA	(Deng et al. 2008)
	GACTCATCGTACTCCTGCTGCTG

^a F: forward primer; R: reverse primer. Tm: melting temperature.

Figure 1. Chemical structures of the isolated flavonoid compounds from D. glabra.

Figure 2. The changes of intracellular ROS levels in liver tissues of male rats exposed to CCl₄ and/or D. glabra extract. DGE: D. glabra extract, DGE L: 50 mg/kg bw, DGE M: 100 mg/kg bw and DGE H: 200 mg/kg bw of D. glabra extract. Data are presented as mean ± SEM. a,b,c,d, are significantly different (p ≤ 0.05).

Figure 3. The alteration of GLAST, GLT-1 and SNAT3-mRNA in liver tissues of male rats exposed to CCl₄ and/or D. glabra leaves extract. DGE: D. glabra extract, DGE L: 50 mg/kg bw, DGE M: 100 mg/kg bw and DGE H: 200 mg/kg bw of D. glabra extract. Data are presented as mean ± SEM. a,b,c,d, are significantly different (p ≤ 0.05).

Figure 4. Rate of DNA fragmentation in liver tissues of male rats exposed to CCl₄ and/or D. glabra leaves extract. DGE: D. glabra extract, DGE L: 50 mg/kg bw, DGE M: 100 mg/kg bw and DGE H: 200 mg/kg bw of D. glabra extract. Data are presented as mean ± SEM. a,b,c are significantly different (p ≤ 0.05).

Table 2. The amount of glutathione peroxidase activity in male rats exposed to CCl₄ and/or D. glabra leaves extract.

Treatment	Glutathione peroxidase activity (U/mg tissues/min)
Control	6.2 ± 0.03^a
CCl4	1.8 ± 0.02^c
DGE L	5.6 ± 0.03^ab
DGE M	6.3 ± 0.05^a
DGE H	7.2 ± 0.04^a
DGE L + CCl4	2.7 ± 0.02^b
DGE M + CCl4	3.4 ± 0.04^b
DGE H + CCl4	4.8 ± 0.05^ab

Data are presented as mean ± SEM. DGE: D. glabra extract; DGE L: 50 mg/kg bw; DGE M: 100 mg/kg bw; DGE H: 200 mg/kg bw of D. glabra extract.

^a,b,cSignificantly different (p ≤ 0.05).

Deng Z-L, Sharff KA, Tang N, Song W-X, Luo J, Luo X, Chen J, Bennett E, Reid R, Manning D, et al. 2008. Regulation of osteogenic differentiation during skeletal development. Front Biosci. 13:2001–2021.

 PubMed Web of Science ®Google Scholar